Calculate the number of different
octapeptides
you can make in which the amino acids phenylalanine, glycine, serine, leucine, histidine, proline, valine, and glutamine are each found.
Enter your
answer in the provided box.
octapeptide
Calculate the number of different octapeptides you can make in which the amino acids phenylalanine, glycine, serine, leu...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
i think it might be Glutamate, but im not sure. Someone please help!! its the last question i need to finish this mindtap. please respond quickly too, its due TODAY at 11:59pm EST CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
Which of the following amino acids is NOT an inhibitor of glutamine synthetase? O Glycine Alanine O Proline O Serine
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in predominant form found at pH = 0. b) What is the isoelectric point? c) What is the average charge on the population of peptide macromolecules at pH = 2.2? d) What is the average charge on the population of peptide macromolecules at pH = 12.5? TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...