Problem

The Polymerase Chain ReactionREFLECT AND APPLY Each of the following pairs of primers has...

The Polymerase Chain Reaction

REFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.

(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'


     Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3' 


     Reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

(c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3' 

     Reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Step-by-Step Solution

Request Professional Solution

Request Solution!

We need at least 10 more requests to produce the solution.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the solution will be notified once they are available.
Add your Solution
Textbook Solutions and Answers Search