DNA methylation is a process, in that methyl group added to DNA
molecules. this action changes the DNA activity without changing
the sequences. In gene, promoter DNA methylation acts as a repress
gene transcription.DNA methylation regulates gene expression by
inhibiting transcription factor binding to DNA, that time DNA
methylation in the genome changes occurs as a result of a dynamic
process involving in de novo DNA methylation and demethylation.
when DNA was hypermythlated it increase the epigenetic methylation
of cytosine to form 5-methylcytosine the reaction occurs and
categorised by DNA methyltransferases.
Bloom's syndrome is a rare autosomal recessive disorder by short
stature and predisposition to the development of cancer and genomic
instability, in which cells' ability for the integrity of DNA is
impaired. In Bloom's syndrome there is a chromosomal breakage
happen with mutator phenotype. This gene disorder as a DNA
helicase, gene plays a major role in immunoglobulin mutation the
people will lack mutated antibodies. These antibodies have a low
affinity to the eliciting antigene somatic hypermutation happen
cause accumulation it dominate the mature antibody response. The
process of mutation and selection in protective antibodies causes
DNA replication that linked to transcription.
What is DNA methylation? Describe how this mechanism regulates the expression of genes. What can happen...
17-11. Methylation of eukaryotic DNA controls gene expression. a) Describe in words the control of methylation of DNA in eukaryotes. b) Describe in words how silencing starts with methylation.
AS Part A Which of the following events occurs during DNA replication? All methylation of the DNA is lost at the first round of replication Methylated DNA is copied in the cytoplasm, and unmethylated DNA is copied in the nucleus Methylation of the DNA is maintained because DNA polymerase directly incorporates methylated nucleotides into the new strand opposite any methylated nucleotides in the template. Methylation of the DNA is maintained because methylation enzymes act at DNA sites where ane strand...
How would I use DNA methylation analysis? What are the steps? Can someone describe to me and a detailed message? I’m trying to get a better understanding of this topic.
Part 1. Eukaryotes use at least two distinct mechanisms to control gene expression by altering the structure of chromatin around a particular gene. One of these mechanisms is the covalent modification of histones to switch DNA between an open and closed confirmation. A second mechanism is the covalent modification of DNA (typically on cytosines) by methylation. A. Describe a type of histone modification and explain what effect is has on chromatin, and how that effect is achieved. a. One type...
Understanding control of gene expression by chromatin regulation We discussed how maternal grooming behavior regulates anxiety and stress response in rats. Rats raised by low-care mothers grow up to be more anxious and guarded adults. Rats raised by high-care mothers on the other hand become more relaxed adults. Below are two key results from the study that discovered this phenomenon. Scientists looked at DNA methylation in the promoter of a gene called glucocorticoid receptor which is expressed in the hippocampus...
Explain how DNA methylation could be used to regulate gene expression in a tissue-specific way. When and where would de novo methylation occur, and when would demethylaiton occur? What would occur in the cells that give rise to eggs and sperm (germ-line cells)
Understanding control of gene expression by chromatin regulation We discussed how maternal grooming behavior regulates anxiety and stress response in rats. Rats raised by low-care mothers grow up to be more anxious and guarded adults. Rats raised by high-care mothers on the other hand become more relaxed adults. Below are two key results from the study that discovered this phenomenon. Scientists looked at DNA methylation in the promoter of a gene called glucocorticoid receptor which is expressed in the hippocampus...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Question 1 Which of the following statements is true? Promoter bashing can lead to increased DNA methylation. Methyl groups are removed from the DNA by DNA methyltransferase. ODNA methylation is directly passed on during meisos to all daughter cells. Monoallelic gene expression occurs when a mutation results in dominant gene expression. Patterns of DNA methylation are preserved in somatic cells following mitosis.
2. Please describe how TPP riboswitch aptamer regulates gene expression.