Question

Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred to the new sequence? indicate what the new sequence will be in the standard 5' rightarrow 3' direction. How does an increase in DNA methylation affect chromatin structure and what does this do gene expressions? Be specific. Describe how chromatin structure is altered in the process of X-inactivations and How the active X-chromosome prevents itself from being inactivated. Include the functions of Jpx, Xist, T six, and describe what each of these gene products do. Be specific.

Answer 1

a.ACAGTCC*GTC*GGAGCCTGCCAGTC*GATC*GATC*GCACCT...Original strand                                                                                                      

Cytosine residues are methylated during DNA methylation and cytosine residue is usually followed by a guanine residue.So it is known as CpG methylation.

b.DNA replication does not transfer methylations to the new strand.Rather, after the DNA strand is replicated, DNA methyl transferases methylate only the cytosine residues that is followed by guanine residues on the new stand.

3' TGTCAGG*CAG*CCTCGGACGGTCAG*CTAG*CTAG*CGTGGA 5'  is the replicated DNA and * indicate methylated regions..

c.DNA methylation results in methylation of cytosine residue that is followed by guanine residue in a DNA strand and this is known as CpG methylation.It has been reported that certain proteins known as methyl CpG binding domain proteins bind to the cytosine methylated DNA.This in turn results in binding of other proteins such as histone deacetylases and chromatin remodelling proteins to the methylated DNA.As a result of binding of all these proteins together,the histone proteins are deacetylated and modified such that it wraps itself around the DNA tightly to form a condensed chromatin known as heterochromatin. As the DNA is now in a compact and condensed form, it becomes less accessible to transcription factors that need to bind to the promoter region in the DNA to start gene expression.So, gene expression is inhibited.

d.In the process of X inactivation,DNA methylation plays an important role.Methylation of one of the X chromosomal DNA results in the condensation of the DNA into a compact structure known as heterochromatin that is usually inactive as it is not accessible to transcriptional proteins to bind to the promoter region and carry out gene expression. It has been hypothesized that there is a presence of a blocking factor that binds to one of the X chromosomes in females and prevents its inactivation while the other X chromosome is inactivated.The XIC or X inactivation centre present on the X chrmosome contains non translated RNA genes known as JPX,Xist ,Tsix to name a few.JPX function is upregulation of Xist.Xist known as X inactive specific transcript produces a non coding 17kb RNA molecule that initates the inactivation of the X chromosome from which itself is formed.The Tsix gene encodes a non coding RNA that in turn down regulates the function of Xist.