Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation...
Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation or alteration of histone proteins is referred to as _____ changes.
A. epigenetic
B. sensitivity
C. mutational
D. genetic
Homework Answers
Epigenetic changes
This chages refer to modification of the DNA, not of the sequence of DNA but of its structure, chaging the structure of chromatin leads to diferent expretion in genes. The chages in the structur can be made trhou methulation, the ading of a methyl group (CH3) to the DNA chain.
Add Answer to:
Alterations of chromatin of DNA structure that are stable and
inheritable in offspring via DNA methylation...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Which statements about the modification of chromatin structure in eukaryotes are true? 2 pts a. Acetylation...
Which statements about the modification of chromatin structure in eukaryotes are true? 2 pts a. Acetylation of histone tails in chromatin allows access to DNA for transcription. b. Histone proteins are always permanently placed along a DNA sequence but the binding to DNA can be loosened. c. Methylation of DNA is associated with the gene activation. d. Acetylation of histone tails is a reversible process. e. Some forms of chromatin modification can be passed on to future generations of cells.
Which of the following hypothesizes that the physical and functional status of a certain region of genomic chromatin is dependent upon the patterns of specific histone posttranslational modifications...
Which of the following hypothesizes that the physical and functional status of a certain region of genomic chromatin is dependent upon the patterns of specific histone posttranslational modifications and/or DNA methylation status? a. PTM hypothesis b. Nuclear body hypothesis c. Epigenetic code d. Genetic code
Regulation of Gene Expression in Eukaryotes Part A -Modification of chromatin structure Which statements about the...
Regulation of Gene Expression in Eukaryotes Part A -Modification of chromatin structure Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply. View Available Hint(s) Acetylation of histone tails is a reversible process Some forms of chromatin modification can be passed on to future generations of cells. DNA is not transcribed when chromatin is packaged tightly in a condensed form. O Acetylation of histone tails in chromatin allows access to DNA for transcription. Deacetylation...
What does the phrase "epigenetic transgenerational inheritance of disease susceptibility" mean? Question options: a) changes to...
What does the phrase "epigenetic transgenerational inheritance of disease susceptibility" mean? Question options: a) changes to factors that affect gene expression, that are passed down to offspring, and affect whether or not offspring will get a particular disease b) changes to DNA sequences, that are passed down to offspring, and affect whether offspring will get a particular disease c) changes to factors that affect gene expression, that can be passed on from offspring to parents, and affect whether or notparents...
Which of the following is not true of DNA methylation? A.The methyl group is attached via...
Which of the following is not true of DNA methylation? A.The methyl group is attached via a strong carbon-carbon bond B.It is heritable across cell division C. t is considered stable enough to mediate X-inactivation D. It interferes with cytosine-guanine binding
In eukaryotes, genomic DNA is wrapped around the histone complex to make chromatin. The direct contacts...
In eukaryotes, genomic DNA is wrapped around the histone complex to make chromatin. The direct contacts between DNA and the histone beads interfere bindings of the transcriptional factor proteins to their cognate sequence elements, decreasing gene activities. To increase transcriptional activity of the affected genes, the RSC/CRC complex remodels chromatins such that the ________ sequences can be amenable to formation of the transcriptional initiation complex. Select one: a. TBP-binding and TAP-binding b. Shine-Dalgarno c. start codons d. All of these...
How do epigenetic traits differ from traditional genetic traits, such as the differences in color and...
How do epigenetic traits differ from traditional genetic traits, such as the differences in color and shape of peas that Mendel studied? A) Phenotype is stably inherited by offspring. B) Phenotype is not transmitted to offspring. C) New phenotype involves changes to the DNA sequence. D) New phenotype is caused by modifications to chromatin. E) Phenotype can be influenced by environmental factors.
The observation that in any DNA sample, A T and G C A. DNase sequencing An...
The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...
Part A. This structure represents the way chromatin would appear during; prometaphase of mitosis metaphase of mitosis G1 phase of interphase metaphase of meiosis ...
Part A. This structure represents the way chromatin would appear
during;
prometaphase of mitosis
metaphase of mitosis
G1 phase of interphase
metaphase of meiosis
Part B. A complete nucleosome is indicated by the letter;
A
B
C
A and B
Part C What does the letter C in this figure represent?
RNA polymerase
transcription factors
a DNA double helix
histone proteins
condensed chromosomes
Part D What is this an image of?
supercoils
a nucleosome
a DNA double helix
histones
loops...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Regulation of Gene Expression in Eukaryotes Part A -Modification of chromatin structure Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply. View Available Hint(s) Acetylation of histone tails is a reversible process Some forms of chromatin modification can be passed on to future generations of cells. DNA is not transcribed when chromatin is packaged tightly in a condensed form. O Acetylation of histone tails in chromatin allows access to DNA for transcription. Deacetylation...
The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...
Part A. This structure represents the way chromatin would appear
during;
prometaphase of mitosis
metaphase of mitosis
G1 phase of interphase
metaphase of meiosis
Part B. A complete nucleosome is indicated by the letter;
A
B
C
A and B
Part C What does the letter C in this figure represent?
RNA polymerase
transcription factors
a DNA double helix
histone proteins
condensed chromosomes
Part D What is this an image of?
supercoils
a nucleosome
a DNA double helix
histones
loops...
Most questions answered within 3 hours.
-
Which statement is not correct?
Mutations change the sequence of nucleotides in DNA.
Mutations can be...
asked 21 minutes ago -
An organization is not required to accommodate an employee's
disability when the accommodation would cause "undue...
asked 20 minutes ago -
Mojo Mining has a bond outstanding that sells for $2,165 and
matures in 17 years. The...
asked 23 minutes ago -
Olympic weightlifter Zoe Smith holds a 58 kg barbell over her
head, 2.1 meters above the...
asked 25 minutes ago -
For sample average = 28 and a μ = 17 and a s = 4 and...
asked 35 minutes ago -
A
short forward contract that was negotiated some time ago will
expire in three months and...
asked 43 minutes ago -
If R = R1L2/L3, what is the measurement error dR based on the
rules of error...
asked 55 minutes ago -
At equilibrium, the concentrations of N2(g),
O2 (g) and NO (g) in a sealed reaction vessel...
asked 56 minutes ago -
Find P(X-bar > 15.5)
n=81, Mean=15, SD=1
asked 1 hour ago -
3. What percentage of search engine users don’t go to the next
page of search results?...
asked 1 hour ago -
Since Tanya Martin retired, she has used income from her
investment in the Alger Mid Cap...
asked 1 hour ago -
Determine the point estimate of the population proportion, the
margin of error for the following confidence...
asked 1 hour ago