example of static problems are:-
An object lying on the floor, In this the resultant force acting on the object is zero. The object will remain in its state until and unless exerted by some any other external force.
Please write down all answers. Thank you so much. Question 2 Homework 1. Provideo an example...
Please write down all answers. Thank you so much.
Question 2 Homework 1. Provide an example of an every-day dynamic problem and an example of a static problem.
Please write down all answers. Thanks.
Question 2 Homework 1. Provide an example of an every-day dynamic problem and an example of a static problem.
Please answer this question!Thank you so much!
4. Write the electron arrangement of the a. 31P. b. 30P c. 30P-3.
This is a simple physics question. please write all answers down
clearly and in the unit of seconds. thank you!
4. + -/20 points CJ10 2.P.017. A motorcycle has a constant acceleration of 2.2 m/s2. Both the velocity and acceleration of the motorcycle point in the same direction. (a) How much time is required for the motorcycle to change its speed from 21 m/s to 33 m/s? (b) How much time is required for the motorcycle to change its speed...
Physics Question
Please answer all parts. Thank you so much!
and
Problem 23.12 Part A An underwater diver sees the sun 66above horizontal. How high is the sun above the horizon to a fisherman in a boat above the diver? Express your answer to two significant figures and include the appropriate units.
Please show all steps, thank you so much !
Please provide justifications for all answers so I
understand. Extra detail is very helpful. Thank you so
much.
Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...
Please, make sure your answers and explain to me. Thank
you so much.
Chapter S4, Problem S4/064 Determine the magnitude of the force which member CD exerts on the pin at C. 365 N В 0.48 m 0.48 m 33//0.58 m 33 0.58 m A D Answer: CD the tolerance is Click if you would like to Show Work for this question: +/-2% Open Show Work
Chem 1 problem. Please answer all with steps.
Thank you so much
2. What is the change in energy associated with the transition of an electron from the n 4 energy level to the n 2 level in a hydrogen atom? What frequency of light does this correspond to? What wavelength of light does this correspond to?
Please only answer if you are confident that your answers/work
are correct! thank you so much!
1 point) Math 215 Homework homework10, Problem 5 In this and the following problem you will consider the integral 4y sin(6x) dx + 4xy dy on the closed curve C consisting of the line segments from (0,0) to (5,3) to (0,3) to (0,0). Here, you evaluate the line integral along each of these segments separately (as you would have before having attained a penetrating...