The causes of gastrointestinal cancer mutation are unclear, however identify and discuss three predisposing factors.
Gastrointestinal cancer is the cancer cells develop in the inner lining of the stomach. The exact cause is unknown. But studies show that chronic inflammation, H.pylori infection, and pernicious anemia increases the risk of gastrointestinal cancer mutation. The predisposing factor that causes gastrointestinal cancer include
Age: People more than 50 years of age are more risk for gastrointestinal cancer as the age increases results in poor function of the gastrointestinal system.
Diet: People who ate an excessive amount of smoked foods, salted fish, meat products, are an increased chance of having Gastrointestinal cancer. Because these food substances contain nitrates which are converted by bacteria and leads to gastrointestinal cancer.
Gastro surgery: Patient who undergone previous gastro surgery are more prone to get of cancer. The reason is the stomach produces less amount of Hcl which allows the nitrate-containing bacteria into the intestine and further reflux of bile from the intestine into the stomach increases the risk factor.
The causes of gastrointestinal cancer mutation are unclear, however identify and discuss three predisposing factors.
The causes of gastrointestinal cancer mutation are unclear, however identify and discuss three predisposing factors.
Describe, in detail, the predisposing factors in the development of peptic ulcer and cite the three complications of peptic ulcer.
What is the role of the transcription factors? A mutation exists in transcription factors that causes them to bind slightly downstream of the TATA box, causing them to cover the first 3 nucleotides of a gene. RNA polymerase can still transcribe the gene to mRNA, but it misses the first 3 nucleotides. How would this impact translation?
What is the role of the transcription factors? A mutation exists in transcription factors that causes them to bind slightly downstream of the TATA box, causing them to cover the first 3 nucleotides of a gene. RNA polymerase can still transcribe the gene to mRNA, but it misses the first 3 nucleotides. How would this impact translation? RNA is single stranded, and as such, undergoes rapid rates of mutation. How would this affect the ability of siRNAs to combat RNA...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
Identify and discuss three causative factors of both emphysema and chronic bronchitis.
Identify and discuss three causative factors of both emphysema and chronic bronchitis.
Discuss the factors affecting how patients cope with cancer
Discuss cancer, it’s causes, and implications. (This should be a long answer!) Consider the following questions in your answer: What is cancer? How is it caused? Why do some people get cancer and other don’t? How do different forms of cancer differ from each other? Is cancer inevitable? Can plants get cancer? Discuss cancer, it's causes, and implications. (This should be a long answer!) Consider the following questions in your answer: What is cancer? How is it caused? Why do...
Identify three factors that determine supply in the market place and discuss how an increase and decrease in that factor will impact supply.