Answer:
*Age and Gender:
Most of the gastrointestinal cancer cases seen in the age above 55 years. It affects men twice when compared to women.
*Genetics:
Mutation of genes like BRCA1,BRCA2 and CDH1 have high risk of developing stomach cancer in their lifetime. HNPCC is associated with increased risk of colon cancer which is predisposing to stomach cancer.
*Lifestyle:
Smoking has linked with stomach cancer and smokers are more likely to get stomach cancer than nonsmokers. Some studies show that,processed meat can increase the risk of stomach cancer. Overweight and obesity are other risk factors for gastrointestinal cancer.
The causes of gastrointestinal cancer mutation are unclear, however identify and discuss three predisposing factors.
The causes of gastrointestinal cancer mutation are unclear, however identify and discuss three predisposing factors.
Describe, in detail, the predisposing factors in the development of peptic ulcer and cite the three complications of peptic ulcer.
What is the role of the transcription factors? A mutation exists in transcription factors that causes them to bind slightly downstream of the TATA box, causing them to cover the first 3 nucleotides of a gene. RNA polymerase can still transcribe the gene to mRNA, but it misses the first 3 nucleotides. How would this impact translation?
What is the role of the transcription factors? A mutation exists in transcription factors that causes them to bind slightly downstream of the TATA box, causing them to cover the first 3 nucleotides of a gene. RNA polymerase can still transcribe the gene to mRNA, but it misses the first 3 nucleotides. How would this impact translation? RNA is single stranded, and as such, undergoes rapid rates of mutation. How would this affect the ability of siRNAs to combat RNA...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
Identify and discuss three causative factors of both emphysema and chronic bronchitis.
Identify and discuss three causative factors of both emphysema and chronic bronchitis.
Discuss the factors affecting how patients cope with cancer
Discuss cancer, it’s causes, and
implications. (This should be a long answer!)
Consider the following questions in
your answer: What is cancer? How is it caused? Why do some people
get cancer and other don’t? How do different forms of cancer differ
from each other? Is cancer inevitable? Can plants get cancer?
Discuss cancer, it's causes, and implications. (This should be a long answer!) Consider the following questions in your answer: What is cancer? How is it caused? Why do...
Identify three factors that determine supply in the market place and discuss how an increase and decrease in that factor will impact supply.