Question

A Photomultiplier tube can detect a single photon, but a photodiode cannot. Why is this? As...

A Photomultiplier tube can detect a single photon, but a photodiode cannot. Why is this? As part of your answer sketch the main components of both devices and describe how they work.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans: Photodiode :- It is a pr-junction diode that converts - light energy into electrical energy. It is designed to work in rPhoto multiplier tubes ; - These are extremely sensitive to light, as - photo electron multiplication takes place at various

Add a comment
Know the answer?
Add Answer to:
A Photomultiplier tube can detect a single photon, but a photodiode cannot. Why is this? As...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • in Aspinho ISO: 1.9 DE 4. Describe how and why the ferric chloride test can be...

    in Aspinho ISO: 1.9 DE 4. Describe how and why the ferric chloride test can be used to detect whether your reaction has gone to completion The main o salicyllic add act asa limotiug reattant to produce

  • Yes, this is one problem. Please solve ALL PARTS. Guaranteed thumbs up for the person who solves it. 3 1. Photodiode...

    Yes, this is one problem. Please solve ALL PARTS. Guaranteed thumbs up for the person who solves it. 3 1. Photodiode amplifier circuit You are designinga CF photosensor circuit for a light detection and ranging LiDAR) system in autonomous vehicles. The circuit utilizes a transimpedance amplifier to convert low-level RF photodiode current signal to a usable voltage output. It consists of a photodiode, an amplifier, and feedback capacitor/resistor pair as shown in Figure 1. We will derive simple equations to...

  • Cerenkov Radiation II, Part C

    *I need help with Part C. Thanks!Electromagnetic radiation (known as Cerenkov radiation) is emitted when a charged particle moves through a medium faster then the local speed of light. It shouldbe stressed that the particle is never going faster then the speed of light in vacuum (or c), just faster than the speed of light in the material (which is alwaysless than c).Copy and paste to see image: http://session.masteringphysics.com/problemAsset/1011249/19/106346B.jpgWhen a charged particle passes straight through a medium faster than the...

  • . Answer the following questions about the blind spot that can be found in each human...

    . Answer the following questions about the blind spot that can be found in each human eye (you may draw a figure if it helps you explain the blind spot but be sure you label this figure clearly) Specify the names of the two layers of the retina? Describe where the photoreceptors are located (be specific) AND if they are more superficial or deep to the majority of the nervous tissue of the eye. Where is the blind spot located...

  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • Describe how an attacker can obtain the one-time pad that is used to encrypt a message,...

    Describe how an attacker can obtain the one-time pad that is used to encrypt a message, given both the message and the ciphertext, and explain why your method works. Suppose that two equal-sized messages M1 and M2 are encrypted with the same one-time pad and let C1 and C2 be the resulting ciphertexts. Suppose further that an attacker captures both ciphertexts C1 and C2, and knows one of the two messages, say M1. Based on Part a), describe how the...

  • The photoelectric effect cannot be explained using classical mechanics but can be understood using quantum mechanics. Describe briefly (a) why a classical description of the photoelectric effect is wr...

    The photoelectric effect cannot be explained using classical mechanics but can be understood using quantum mechanics. Describe briefly (a) why a classical description of the photoelectric effect is wrong and (b) how a quantum mechanical description is correct

  • 1. Determine (by inspection) why the vectors below can or cannot be linearly independent. Explain your...

    1. Determine (by inspection) why the vectors below can or cannot be linearly independent. Explain your answer. [ 31 rol [6] (a) 5 1,0 5 [-1] [ 0 ] [ 4 (b) | | [3][] 2 -11 L aan RS then

  • Please help with the last part! Consider a pretend atom for which the electrons can be...

    Please help with the last part! Consider a pretend atom for which the electrons can be in any one of the following energy states: Label Energy A -3.000x10-19j В -5.000x10-19j C -8.000x10-19 -1.400x10-18] Start by arranging the four levels on a graph, then answer the following questions. An electron jumps from one energy state to another, as described in each of the statements below. Describe whether a photon is absorbed or emitted in the process. Emitted: From level B to...

  • 1. Give the main reason why two indifference curves can never intersect! 2. Why does a...

    1. Give the main reason why two indifference curves can never intersect! 2. Why does a higher indifference curve (further right) represents a higher level of utility? 3. Describe a scenario of your own choice where the substitution effect of a price increase will have the same sign (positive or negative) than the income effect! 4. For a price decrease related to a Giffen goods, describe the signs of both the substitution effect as well as the income effect.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT