Homework Answers
The dsDNA1 has more GC base pairs than that of the dsDNA2.
Since there are three hydrogen bonds between GC or CG base pairs. Therefore dsDNA1 has more number of hydrogen bonds than that of the dsDNA2.
Hence the melting temperature of of ds DNA1 is higher than the dsDNA2. As such dsDNA1 requires more energy to get denatured.
Therefore the dsDNA 2 will require less energy to be separated.
Thank you
Add Answer to:
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA...
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA (dsDNA) it is much more flexible with its persistence length (lp) estimated to be an order of magnitude lower than that for dsDNA. If a particular dsDNA sequence has a (4-63 nm): a) Estimate at what concentration of NaCl dsDNA flexibility is comparable to that of ssDNA [NaCl]- a) Estimate at what concentration of MgCl2 dsDNA flexibility is comparable to that of SSDNA [MgCl2]-
Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded...
Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded form) or can exist as separate strands ("random coils"), depending on the position of the equilibrium shown below. Double-stranded form < = = > single strands ("random coil") With regard to Enthalpy and Entropy, match the interactions that favor the form of DNA listed. What is the enthalpic term favoring single stranded DNA? A. Hydrogen Bonding B. Conformational C. Base Stacking D. van der...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due...
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...
Draw a figure of one double stranded DNA molecule that has initiated replication and produced two...
Draw a figure of one double stranded DNA molecule that has initiated replication and produced two okazaki fragment in each lagging strand. The figure must include both template strands, all newly synthesized DNA molecules on both leading and lagging strands, all RNA primers, direction of chain growth for each fragment/strand indicated with arrowheads, direction of replication forks. Each molecule must be labeled with the origin of replication on both strands, leading and lagging strands labeled, template or newly synthesized, DNA...
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic reco...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA (dsDNA) it is much more flexible with its persistence length (lp) estimated to be an order of magnitude lower than that for dsDNA. If a particular dsDNA sequence has a (4-63 nm): a) Estimate at what concentration of NaCl dsDNA flexibility is comparable to that of ssDNA [NaCl]- a) Estimate at what concentration of MgCl2 dsDNA flexibility is comparable to that of SSDNA [MgCl2]-
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
Most questions answered within 3 hours.
-
4. Determine the theoretical yield of P2O5, when 3.07 g of P
reacts with 6.09 g...
asked 54 minutes ago -
Explain the PEST analysis and how a marketer would use this when
putting together a marketing...
asked 37 minutes ago -
S sells property with a $500 basis to B for $450, and B later
sells the...
asked 1 hour ago -
True/False Questions
1.
In interpreting an agreement, courts generally apply a
subjective standard.
2.
If, after...
asked 42 minutes ago -
On January 1, 20X7, Green Corp. paid $1,020,000 to acquire Wax
Co. Wax maintained separate incorporation....
asked 1 hour ago -
C++
Write a class Fraction that defines adding, subtracting,
multiplying, and dividing fractions by overloading standard...
asked 3 hours ago -
This java code won't run and I can't figure out the problem with
it. Please help...
asked 4 hours ago -
Trace the following recursive methods:
a) isPal with the string “abccda”
b) isAnBn with the string...
asked 5 hours ago -
1. Which of the following is false about photosynthesis?
A. ATP is the molecule used to...
asked 5 hours ago -
A simple random sample of size n=64 is obtained from a
population with a mean of...
asked 6 hours ago -
(2 dimensions, 1 object, 2 accelerations)
1) A projectile is thrown with a wind. The wind...
asked 7 hours ago -
Brian makes $34,100 per year. How much can Brian expect to
contribute to FICA taxes in...
asked 8 hours ago