Homework Answers
Answer(1):
DNA coding strand GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCTATACCGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC
DNA template strand CACTACGCCGCGCGCGGTGGTGTACACTTTTTTATTGAGGCCGTAATGCTTGGAGCTTCTTAGCCCTAAATCGGTAATATCGATCGG
mRNA GUGAUGCGGCGCGCGCCACCACAUGUGAAAAAAUAACUCCGGCUAUACCGAACCUCGAAGAAUCGGGAUUUAGCCAUUAUAGCUAGCC
Answer(2): GUG - N terminal of mRNA
GUG- Valine amino acid
Add Answer to:
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
please help The following diagram shows a fragment of transcribed DNA, and the upper strand is...
please help
The following diagram shows a fragment of transcribed DNA, and the upper strand is the non-template strand: 5 TAACGG 3 3' ATTGCC 5 The transcribed RNA can be represented by? d. 5' UAACGG 3 c. 5' AUUGCC 3 O O b. 5 TAACGG 3 a. 5' AUUGCC 3 The primary structure of a polypeptide is: O a) the sequence of nucleotides on the DNA molecule that encodes the protein. b) the linear sequence of amino acids that constitutes...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.
Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...
Part C
this is for Genetics
UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded...
hi please help. im having trouble with transcribing the given
dna fragment!
1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...
3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products...
3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication....
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
please help
The following diagram shows a fragment of transcribed DNA, and the upper strand is the non-template strand: 5 TAACGG 3 3' ATTGCC 5 The transcribed RNA can be represented by? d. 5' UAACGG 3 c. 5' AUUGCC 3 O O b. 5 TAACGG 3 a. 5' AUUGCC 3 The primary structure of a polypeptide is: O a) the sequence of nucleotides on the DNA molecule that encodes the protein. b) the linear sequence of amino acids that constitutes...
Part C
this is for Genetics
UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
hi please help. im having trouble with transcribing the given
dna fragment!
1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...
Most questions answered within 3 hours.
-
The mean waiting time at the drive-through of a fast-food
restaurant from the time an order...
asked 11 minutes ago -
The pitch (p) of a helix is defined as p = dn, in which n is...
asked 13 minutes ago -
Do you agree that the declining stock of social capital is the
blame for the failure...
asked 17 minutes ago -
A researcher is interested in whether coffee consumption helps
with performance on reading comprehension tasks. The...
asked 27 minutes ago -
it has been estimated since the beginning of the human race that
about 133 metric ton...
asked 32 minutes ago -
Where must Medicare prescription drug plans allow for
participants to fill their prescriptions?
asked 35 minutes ago -
Five moles of monatomic ideal gas have initial pressure 2.50 ×
103 Pa and initial volume...
asked 50 minutes ago -
A resistor and the capacitor are used to control the timing in
the RC circuit of...
asked 50 minutes ago -
Living in a group could bring several disadvantages to an
individual. What are some of the...
asked 1 hour ago -
Complete and balance the following reactions. In case of no
reaction occurring write NR.
Mix #1:...
asked 1 hour ago -
If an economy consumes 75% of any increase in income, then an
increase in autonomous investment...
asked 1 hour ago -
A shotputter throws the shot with an initial speed of 15.8 m/s
at a 38.0 ∘...
asked 1 hour ago