Question

1. A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair. +1 5 TATATTTTCTATATGCACATTTGCAAGTAA 3 (strand A) 3 ATATAAAAGATATACGTGTAAACGTTCATT 5 (strand B) (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (0.5 pts.) (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the 5 and 3 ends, and noting any modifications that would be added to a mature mRNA molecule in a EUKARYOTE (0.5 pts). (C) Label the following on your mRNA above: start codon, stop codon, 5UTR, 3 UTR (0.5 pt.) (D) Using the genetic code at the end of this exam, determine the sequence of the polypeptide that would be translated from the mRNA you determined in (B) (0.5 pts.) (E) Note the base pair in the DNA molecule at the beginning of this problem that is labeled with an arrow. For the following changes in the DNA at that base pair, indicate the new codon that would be transcribed and then translated, and the name of the type of mutation (0.25 points each, 1 pts total). Type of base change New codon New amino acid/translated Name of mutation type codon Transition Tran version #1 Transversion #2 Insertion of a TA base pair at the beginning of the codon

0 0
Add a comment Improve this question Transcribed image text
Answer #1

A.

TATATTTTCTATATATGCACATTTGCAAGTAA Promoter region

Strand B is the template strand

B.

5 UAUAUUUUCUAUAUAUGCACAUUUGCAAGUAA 3

C.

Start codon Stop codon 5 UAUAUUUUCUAUAUAUGCACAUUUGCAAGUAA 3 5 UTR

D. Met His Iso Cys Lys Stop

E.

Type of base change New codon New amino acid/translatedName of mutation type codon Transition Tranversion #1 Transversion #2

Add a comment
Know the answer?
Add Answer to:
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded...

    hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...

  • Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...

    Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...

  • Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...

    Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...

  • The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...

    The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...

  • Consider the following segment of DNA is part of a gene,

    Consider the following segment of DNA is part of a gene, Left  5'.... ACTGACTGACAGTC..3'        3'.... TGACTGACTGTCAG... 5'  RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

    I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT