Question

Consider the following segment of DNA is part of a gene,


Consider the following segment of DNA is part of a gene, 

Left  5'.... ACTGACTGACAGTC..3' 

       3'.... TGACTGACTGTCAG... 5'  RIGHT 


during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to translate the mRNA into peptide. Please note that there could be more than one reading frames.) 

1 0
Add a comment Improve this question Transcribed image text
Answer #1

The DNA segment is

5’ – ACTGACTGACAGTC – 3’

3’ – TGACTGACTGTCAG – 5’

Since the RNA polymerase always move from right to left, the mRNA sequence that it will form is

5’ – ACUGACUGACAGUC - 3”

Now, moving on we know that each of the amino acid is a series of three nucleotide which is known as codon. Based on the sequence, the mRNA is determined and then it can be translated into the peptide.

5 ‘ – Thr – Asp – stop – 3”

5” – AC – Stop -3”

5” – Stop - Leu - Thr - Val -3”

Add a comment
Know the answer?
Add Answer to:
Consider the following segment of DNA is part of a gene,
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • 11. A gene is best defined as a. A segment of DNA b. Three nucleotides that...

    11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....

  • 4. Given the following information: One strand of a section of DNA isolated from E. coli...

    4. Given the following information: One strand of a section of DNA isolated from E. coli reads                                     5’-GTAGCCTACCCATAGG-3’                                     3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...

  • QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features...

    QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • 2. For the following short segment of a DNA strand, complete the following table. The codon...

    2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page. Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...

  • 3. Translation. According to the rules of the genetic code, there are six different reading frames...

    3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...

  • “Unlike what happens in DNA replication, where both strands are copied, only one of the two...

    “Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...

  • The following double stranded segment of DNA is part of a protein coding gene. The segments...

    The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT