Templete strand will be coded for mRNA
Thymine in DNA will be replaced by Uracil in mRNA.
Capping at 5' end by methyl guanosine triphosphate (mGppp).
Polyadenylation that is addition of poly A tail at 3'.
INTRONS will be removed by snRNPs ( snups)
Exons are joined by lipase.
The following double stranded segment of DNA is part of a protein coding gene. The segments...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....
The diagram below shows a segment of DNA containing an imaginary gene (Z) and the primary RNA transcript that results from the transcription of gene Z. Exons are represented in green and introns are represented in blue. Which of the following choices represent mRNA molecules that could be produced from the primary RNA transcript by alternative RNA splicing? (In each choice, the yellow part on the left represents the 5' cap, and the yellow part on the right represents the...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
Consider the following segment of DNA is part of a gene, Left 5'.... ACTGACTGACAGTC..3' 3'.... TGACTGACTGTCAG... 5' RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...