Question

Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA (dsDNA) it is much more fl

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

a) Estimate at what concentration of NaCl dsDNA flexibility is compareable to that of ssDNA

[NaCl] = 2 nM

b) Estimate at what concentration of MgCl2 dsDNA flexibility is comparable to that of ssDNA

[MgCl2] = 5 nm

-------------------------------------------------

Add a comment
Know the answer?
Add Answer to:
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT