Answer:
a) Estimate at what concentration of NaCl dsDNA flexibility is compareable to that of ssDNA
[NaCl] = 2 nM
b) Estimate at what concentration of MgCl2 dsDNA flexibility is comparable to that of ssDNA
[MgCl2] = 5 nm
-------------------------------------------------
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT