Explanation and answer find tn AH for thereaction below,aiven the μ 2.SH
Question 1 O points Save Answer Pentaborane B SH (s) burns vigorously in O 2 to give B 20 30s) and H 2001). Calculate H xn for the combustion of 5.00 mol of B SH 9. AH [B 20 3()] = -1,273.5 kJ/mol AH" fB SH 9()] - 73.2 kj/mol AH" fH 20(1 -285.8 kJ/mol For the toolbar, press ALT+F10 (PC) or ALT+FN+F10(Mac). TTT Arial .3(12pt) .T.E.E..225 Path:p Words:0
Please answer all parts.
(2) (a) Give an example of sequences (sn) and (tn) such that lim sn ntoo 0, but the sequence (sntn) does not converge does not converge.) (b) Let (sn) and (tn) be sequences such that lim sn (Prove that it O and (tn пH00 is a bounded sequence. Show that (sntn) must converge to 0. 1 increasing subsequence of it (b) Find a decreasing subsequence of it (3) Consider the sequence an COS (а) Find an...
Question Find the explicit formula for the arithmetic sequence tn given the information below. ti = -1 ta = 20
Find the test statistic, t, to test the hypothesis that μ 1 < μ 2. Two samples are randomly selected and come from populations that are normal. The sample statistics are given below. n 1 = 15 n 2 = 15 x ¯ 1 = 21.14 x ¯ 2 = 23.69 s 1 = 2.9 s 2 = 2.8 Group of answer choices
Find μ if μ ΣΙΧ.P(x)]. Then, find σ if σ2 ΣΙΧ2 . P(x)-μ2. 2 5 2 P)0.0002 0.00530.0450 0.19190.4089 0.3487 H(Simplify your answer. Round to four decimal places as needed.) ơ- (Simplify your answer. Round to four decimal places as needed.) Enter your answer in each of the answer boxes.
2. Suppose that we have n independent observations x1, ,Tn from a normal distribution with mean μ and variance σ2, and we want to test (a) Find the maximum likelihood estimator of μ when the null hypothesis is true. (b) Calculate the Likelihood Ratio Test Statistic 7-2 log max L(μ, σ*) )-2 log ( max L(u, i) μισ (c) Explain as clearly as you can what happens to T, when our estimate of σ2 is less than 1. (d) Show...
15. (2 pts) Tn/0 is a cut-and-paste (conservative) transposon. Assume that the target DNA site below is cut by Tn/0 transposase as shown below by arrows 5' GGACTAGGTTTAGCCTCCACT CCTGATCCAAATCGGAGGTGA Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows.
please explain the steps to get to the answer
Find AH° for the reaction: 2 C,H,OH (1) + 0, (g) → 2 CH CHO (g) + 2 H,0 (9) GIVEN: C,H,OH (1) + 3 0, (g) → 2 CO, (g) + 3 H,0 (9) AH° = -1236 kJ 2 CHỊCHO (g) + 5 0, (g) + 4CO, (g) + 4 H,O (g) AH = -2207 kJ 2 CH OH (1) + 6 0, () — 4 CO, (g) + 6...
Case Study Time Myoglobin Tn T CK-MB 1 day - ++ - 2 day - ++ - 3 day - ++ - 6 day - ++ - Please answer the following questions: Does this patient have heart disease? Explain. Give an explanation for the increase in TnT.
7. Use the thermochemical equation below to find the AH of the following: CH.(g) + H2O(g) → CO(g) + 3 H2(g) AH = +206 kJ 2CH(g) + 2H2O(g)} 2 CO(g) + 6H2(g) AH CO(g) + 3 H2(g) → CH(g) + H2O(g) AH AH 2 CO(g) + 6 H2(g) → 2 CH:(g) + 2 H2O(g)