Question

Justify the answers please

1. Rank the following DNA fragments by Tm, lowest to highest (5 pts) i. GATATATATTITATAAAATATTAC ii. TGCGCCGGCCGCGCCCCCCCGCGA iii.GATATATAGCGCCATAAGCTATTA 2. A 20-year-old anemic man is found to have an abnormal form of B-globin that has 172 amino acids, rather than the 141 found in the normal protein. Which of the following point mutations is consistent with this abnormality (5 pts)? A, TAA → CAA B.CGA-. TGA C.TAA → TAG D.GAT. → GAC 3. Describe how E. coli cells distinguish between template and freshly copied DNA strands (15 pts) 4. Which process requires ribonucleotides (2 pts)? 5. Which process requires deoxyribonucleotides (2 pts)? 6. Which process requires dideoxyribonucleotides (2 pts)? 7. A photon of UV light hits a copy of the BRCAl gene in a man's skin cell, mutating it. What is the probability his daughter will inherit this dominant loss-of-function allele, putting her at increased risk of breast cancer (5 pts)? 8. What enzyme complex does streptomycin inhibit (4 pts)?

Answer 1

Ques 4. Deoxyribonucleotides in turn are used in the synthesis of DNA These are dATP, dGTP, dTTP and dCTP. The four individual deoxynucleotides which make up a DNA sequence (i.e. deoxyadenosine triphosphate, dATP; deoxythymidine triphosphate, dTTP; deoxy cytosine triphosphate, dCTP; and deoxy guanosine triphosphate, dGTP)

Ques 5. Ribonucleotides are normally incorporated into DNA as primers for lagging strand synthesis, after which they are removed by exonucleolytic action Ribonucleotides are also utilized in other cellular functions. These special monomers are utilized in both cell regulation and cell signaling as seen in adenosine-monophosphate (AMP). Furthermore, ribonucleotides can be converted to adenosine triphosphate (ATP), the energy currency in organisms. Ribonucleotides can be converted to cyclic adenosine monophosphate (cyclic AMP) to regulate hormones in organisms as well. In living organisms, the most common bases for ribonucleotides are adenine (A), guanine (G), cytosine(C), or uracil (U). The nitrogenous bases are classified into two parent compounds, purine and pyrimidine.

Ques6. Dideoxynucleosides are chain-elongating inhibitors of DNA polymerase, used in the Sanger method for DNA sequencing which was developed by Frederick Sanger. This can lead to the termination of the DNA sequence. Thus, these molecules form the basis of the dideoxy chain-termination method of DNA sequencing.