Question

In DNA replication, the ________ strand grows towards the replication fork, while the ________ strand grows...

  1. In DNA replication, the ________ strand grows towards the replication fork, while the ________ strand grows away from
    the replication fork.
  1. mRNA; leading
  2. leading; lagging
  3. leading; template
  4. lagging; template
  5. lagging; leading
  1. Which of the following is not necessarily related to tumour formation?
  1. an overactive MYC gene
  2. proto-oncogenes
  3. inactive tumour-suppressor genes
  4. cell de-differentiation
  5. metastasis
  1. The total number of unique, three-base combinations of the four nucleic acid bases in DNA is
  1. 12.
  2. 16.
  3. 20.
  4. 64.
  5. 256.
  1. The purpose of cloning is
  1. to sequence a particular gene.
  2. to obtain large numbers of a particular gene.
  3. to obtain plasmids with a variety of genes.
  4. to insert genes into plasmids
  5. all of the abov
  1. Which of the following is NOT correct for PCR?
  1. It produces large amounts of DNA in a host, usually a bacterium.
  2. It requires the presence of primers.
  3. It can produce DNA from the root of a single human hair.
  4. Some steps are carried out at high temperatures.
  5. It works with a heat resistant DNA polymeras
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. Option B, leading strand moves in 3' to 5' direction towrds fork while lagging moves 5'to3' direction away from fork.

2. Option A, an overactive MYC gene, this gene results in gene expression not division so it do not induce tumor formation.

3. Option D, 64, this is a triplet code

4. All of above

5. Option A, It produces large amounts of DNA in a host, usually a bacterium.

PCR is a machine in which amplification of dna takes place not in bacteria

Please do like the answer

Add a comment
Know the answer?
Add Answer to:
In DNA replication, the ________ strand grows towards the replication fork, while the ________ strand grows...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • what property allows the leading strand of the replication fork to proceed more rapidly than the...

    what property allows the leading strand of the replication fork to proceed more rapidly than the lagging strand? A) the DNA unwinds more rapidly B) fewer nucleosomes to remove C)greater helices activity D) polarity of the template DNA QUESTION 39 What property allows the leading strand of the replication fork to proceed more rapidly than the lagging strand? le DNA unwinds more rapidly fewer nucleosomes to remove greater helicase activity polarity of the template DNA

  • The lagging strand in DNA replication?: (A) is synthesized after the leading strand. (B) causes the...

    The lagging strand in DNA replication?: (A) is synthesized after the leading strand. (B) causes the formation of Okazaki fragments in the leading strand. (C) is a consequence of replicating both strands of template DNA at a single replication fork. (D) requires its own replisome.

  • QUESTION 3 Replication Now DNA Origin of replication DOC Replication fork B CON RO Unreplicated DNA...

    QUESTION 3 Replication Now DNA Origin of replication DOC Replication fork B CON RO Unreplicated DNA Prokaryotic DNA The above diagram shows DNA replication in bacterial cells. An antibody specific only to DNA polymerase I was added to DNA undergoing replication in bacterial cells. Which of the following statements are CORRECT? a. There would be a higher concentration of antibodies on the leading strands of replication foris A and B and a lower concentration of antibodies on the lagging strands...

  • Formation of a replication fork results in: A. continuous synthesis of DNA on the lagging strand....

    Formation of a replication fork results in: A. continuous synthesis of DNA on the lagging strand. B. supercoiling in the parental DNA ahead of the fork. C. of new 3' -OH regions on the template DNA. D. binding of SSB protein on the double-stranded parental DNA. E. All of the above occur when the replication fork is formed.

  • Describe the process of DNA replication. (Your answer should include the following: replication fork, semiconservative replication,...

    Describe the process of DNA replication. (Your answer should include the following: replication fork, semiconservative replication, replication fork, DNA gyrase, helicase, primase, DNA polymerase, DNA ligase, leading strand, lagging strand, continuous replication, non-continuous replication, and Okazaki fragment)

  • Below is a figure of a DNA molecule undergoing replication. The arrow indicates the direction the...

    Below is a figure of a DNA molecule undergoing replication. The arrow indicates the direction the replication fork is moving during synthesis. From the list provided, indicate which option fits best in each box on the diagram. 21       [ Choose ]            leading strand            template strand            lagging strand       22       [ Choose ]            leading strand            template strand            lagging...

  • Vocabulary: DNA Replication

    Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase .1. Site where the replication of a DNA molecule begins. 2. The new continuous complementary DNA strand synthesized in the direction for the replication fork. 3. A discontinuously synthesized DNA strand that elongates in a direction away from the replication fork 4. Relaxes...

  • 1. A mutation in the gene for DNA ligase will impact which strand during DNA replication...

    1. A mutation in the gene for DNA ligase will impact which strand during DNA replication a. The leading b. The laggingc. Both the leading and the lagging d. Neither the leading strand or the lagging strand

  • DNA Replication. Sketch a replication fork of bacterial DNA in which one strand is being replicated...

    DNA Replication. Sketch a replication fork of bacterial DNA in which one strand is being replicated discontinuously and the other is being replicated continuously. List six different enzyme activities associated with the replication process, identity the function of each activity, and show where each would be located on the replication fork. In addition, identify the following features on your sketch: DNA template, RNA primer, Okazaki fragments, and single-stranded DNA binding protein.

  • The following is an image of a section of dna. if a replication fork is moving...

    The following is an image of a section of dna. if a replication fork is moving from right to left, which strand (top or Bottom) is the template strand for the leading strand. 3' AAATCGCGATCGATGGTCTGAGTTTGAATC 5' 5' TTTAGCGCTAGCTACCAGACTCAAACTTAG 3'

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT