Answer:
18.(d) size,Charge
In two dimension gel electrophoresis of isolated proteins, first they are subjected to Isoelectric isolation and then size exclusion. As different proteins has different amino acid composition, they have different charges on them. So they are first separated on the basis of their charge . Then they are treated with SDS so that they are all negatively charged, PAGE is done in a vertical manner to the previous process. PAGE helps in separation of proteins in the basis of size.
14.(c) the percentage of the genome devoted to coding sequence in eukaryotic genome is lower than in prokaryotic genome.
Prokaryotes are simple and primitive organisms but they use their genome rather efficiently. About 88% of their genome is coding genome. Whereas in eukaryotes like human, only 2% of the genome is coding portion. There is no certain explanation for this fact. Eukaryotes have multiple origin and prokaryotes have single origin. Being more sophisticated, it has more regulatory sequences and is larger than prokaryotic genome. Both eukaryotes and prokaryotes have transposons. So all these facts are wrong in the options and only (c) is the correct answer.
Please post the questions separately to know all the answers.
Give a thumbs up if you like the answer. Thank you:)
estion 18 and Two-dimensional gel electrophoresis separates proteins based on a. size; shape b.shape; charge C....
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...
Question 7 estion 7 0.3125 points Suppose that in a Sanger sequencing reaction, sequences are readable for a few dozen nucleotides but then become increasingly difficult to road. It is determined that the chains are terminated to readily. What is the most likely cause? a. Too much of the dNTPs b. Insufficient fluorescent dye Too much fluorescent dye d. Incorrect primer e. Insufficient dNTPs Question of 20 Moving to another question will save this response Question 13 Which statement comparing...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...