Provide an overview of the 3 main results of DNA mutations.
1.)The majority of mutations have neither negative nor positive effects on the organism in which they occur. These mutations are called neutral mutations. Examples include silent point mutations. They are neutral because they do not change the amino acids in the proteins they encode.
2.) Evolution- Some mutations have a positive effect on the organism in which they occur. They are called beneficial mutations. They lead to new versions of proteins that help organisms adapt to changes in their environment. Beneficial mutations are essential for evolution to occur. They increase an organism’s changes of surviving or reproducing, so they are likely to become more common over time. There are several well-known examples of beneficial mutations. Here are just two:
3. )Any random change in a gene's DNA is likely to result in a protein that does not function normally or may not function at all. Such mutations are likely to be harmful. Harmful mutations may cause genetic disorders or cancer.
Provide a thorough overview of Provide a thorough overview of Malabsorption syndrome (2-3 paragraphs).
Free radical damage to DNA often results in I. pyrimidine dimers II. point mutations III. insertions IV. base excision I only. II only. I, II. II, III. I, IV.
Temperature sensitive mutations are used to analyze biochemical pathways. A variety of mutations affecting DNA replication have been isolated in E. coli. What would you predict to see in the DNA after a mutation in each of the following occurred? (Answer each letter separately) (a) DNA ligase (b) DNA polymerase I (c) DNA polymerase III (d) Primase (e) Initiator Protein
What’s the normal frequency at which DNA-Pol δ/ε introduces mutations in the DNA during replication? A) 10-8 B) 10-5 C) 10-3
if mutations leading to proteins involved in DNA repair begin inactivating, mutations can ____ accumulate in a cancer cell. THis is refered to as ___? a. slowly, stability phenotype b.rapidly, mutator phenotype c. slowly, alteration phenotype d. rapidly, stability phenotype
DNA mutations that change DNA sequence occur during: 1) replication O2) transcription 3) translation 4) protein synthesis A person has an adrenal tumor with increased secretion of aldosterone. They might develop secondary hypertension with an: 1) increase in potassium and blood volume O2) decrease in potassium and blood volume 3) increase in potassium and decrease in blood volume O4) decrease in potassium and increase in blood volume
Mutations are heritable changes in DNA. They are essential to the study of genetics and are useful in many other biological fields. How are mutations used to help in understanding basic biological processes? What is the SOS system and how does it lead to an increase in mutations? What is the purpose of the Ames test? How are his- bacteria used in this test?
Provide an overview of reusable packaging materials 4. Provide an overview of disposable packaging materials 5.
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...