in a sedimentary sequence, each bed is a representative of the type of the environment in which is being deposited
hence the correct option is a change in environment and energy
Question 77 1 pts In a bedded sequence of sedimentary rocks, what does each bed represent...
Question 1 1 pts In the equation Q = CV, what does the Q represent? The point charge with which you can measure capacitance. The amount of charge on the positive plate of the capacitor. The maximum amount of charge that capacitor can hold. The total charge on the capacitor. Question 2 1 pts Doc Physics calls "capacitance" the "efficiency of storing without raising much." charge, voltage charge, energy energy, temperature voltage, charge 0 Question 3 1 pts When integrating...
For a system of mass m, what does the quantity mc02 represent? Question 7 0 1 pts For a system of mass m, what does the quantity mco represent? The total energy The relativistic energy None of the above The internal energy
Question 1 0.5 pts The recently discovered 'hobbit' fossils represent some of the most recent members of the genus Homo. True False Question 2 0.5 pts According to the Scientific American article you read, humans have stopped evolving as a species for the last 10,000 years due to technology. True False Question 3 0.5 pts The recently discovered fossil remains that have been referred to as 'Hobbits' due to their small stature has the scientific name Homo erectus. True False...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
1 pts Question 11 U What does this graph represent? 12- 10- 50 30 Volume Titrant (mL) The titration of a strong acid using a strong base. The titration of a strong base using a strong acid. The titration of a weak acid using a strong base. The titration of a weak base using a strong acid. The titration of a weak base using a weak acid. The titration of a Ca?solution using a solution of CO 2 The titration...
Melisa Ulutas ISLE 7.8 1. What does the horopter represent? 2. What happens to objects in front of or behind the horopter in terms of how they are mapped on to the retina (e.g., what is crossed/uncrossed disparity?) 3. What happens to the eyes as the fixation point moves closer or farther? (describe how the eyes change position)
Question 1 3 pts 1. Where does all the water go? According to the Environmental Protection Agency (EPA), in a typical wetland environment, 45% of the water is outflow; 35% is seepage; 15% evaporates, and 5% remains as water volume in the ecosystem. Chloride compounds as residuals from residential areas are a problem for wetlands. Suppose that in a particular wetland environment the following concentrations (mg/l) of chloride compounds were found outflow, 65; seepage. 77; remaining due to evaporation, 40;...
Question 71 pts What is an isotope? Group of answer choices An atom that has more or fewer neutrons than it typically does An atom that has double the protons of a stable atom A nucleus of an atom that has split during the decay process An atom that has more or fewer electrons than it typically does Flag this Question Question 82 pts When the radiometric clock starts ticking in zircon minerals, there is 100% of the unstable radiometric...
1 pts Question 11 What does this graph represent? 14 12 10- 6 2 0 10 50 60 20 30 40 Volume Titrant (ml) The titration of a strong acid using a strong base. The titration of a strong base using a strong acid. The titration of a weak acid using a strong base. The titration of a weak base using a strong acid. The titration of a weak base using a weak acid. The titration of a Ca2solution using...
Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA sequence below? 5' - TTACCGCTA - 3' (TEMPLATE STRAND) 3' - AATGGCGAT - 5' (CODING STRAND) 5'|TTACCGCTA | 3 5'TUAGCGGUAA3 5'UUACCGCUA13' 5'| TAGCGGTAA3