Question

1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of a protein from a ribosome through the endomembrane system to outside of the cell. Be specific and name molecules involved. A well- labeled diagram can help. 5. (5 pts.) Cells normally don't move from one tissue to another. But in late stages of cancer, cells move from one tissue to another. Using what you know about cell connections, explain what would have to happen for cancer cells to Fhove to a new tissue.

Answer 1

1. A tRNA is an RNA molecule with a three-base anticodon which is complementary to a given mRNA unit of genetic code. tRNA essentially is an adapter in translation

So the tRNA sequence will be: A is complimentary to U and G is complimentary to C. So the mRNA will have complimentary sequences to the DNA and tRNA.  

The tRNA sequence will be: UGUGAUGACGAACGAGGGACUGA

The amino acid sequence will be CDDERGT.

P.S. Due to our guidelines we cannot answer more than one question at a time. Please post separately.