Homework Answers
Answer 1:- The mRNA given is:-
UGUGAUGACGAACGAGGGACUGA
The tRNA will be:-
ACACTACTGCTTGCTCCCTGACT
Amino acid sequence will be:-
Cys-Asp-Asp-Glu-Arg-Gly-Thr
Answer 3- The diagram depicting initiation of transcription in prokaryote:-
Add Answer to:
1. The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
(6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start...
(6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the -10 and the -35 sites and RNA polymerase plus sigma factor.
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
Question 1 Match the term with the best definition or description; most topics relate to the...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid...
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid sequence?
Which of the following are directly involved in translation? Choose all five correct answers. mRNA amino...
Which of the following are directly involved in translation? Choose all five correct answers. mRNA amino acids helicase rRNA DNA template RNA polymerase basal transcription factors tRNA initiation and termination factors (proteins) sigma
Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
(6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the -10 and the -35 sites and RNA polymerase plus sigma factor.
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid sequence?
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
Most questions answered within 3 hours.
-
1. The correlation coefficient determined for two variables has
a value of 0.89. Describe, in words,...
asked 3 minutes ago -
The following data relate to direct materials costs for
November:
Actual costs
4,700 pounds at $5.35...
asked 1 minute ago -
Kyle, a 95.0 kg football player, leaps straight up into the air
(with no horizontal velocity)...
asked 25 minutes ago -
Which of the following is a measure of profitability?
A.
Quick (acid-test) ratio
B.
Net sales...
asked 28 minutes ago -
Find the total pressure exerted by 2 grams of ethane and 3 grams
of CO2 contained...
asked 29 minutes ago -
A fireman standing on a 5.2 m high ladder operates a water hose
with a round...
asked 25 minutes ago -
A cream formulation is studied for accelerated stability study.
Creaming was observed when formulation was tested...
asked 28 minutes ago -
A 1,150 lumen light bulb is placed 37 cm in front of a mirrored
wall, whose...
asked 39 minutes ago -
Given that z is a standard normal random variable, compute the
following probabilities (to 4 decimals)....
asked 45 minutes ago -
You begin preparation of the calibration curve to measure
absorbance vs concentration of FeSCN2+. To do...
asked 1 hour ago -
When you speak after breathing helium, in which the speed of
sound is much greater than...
asked 55 minutes ago -
3. Stock Valuation: You are the CEO of Under Armour, Inc. and
are thinking about how...
asked 59 minutes ago