The process of RNA synthesis in bacteria begins with the binding of RNA polymerase molecule on the DNA. RNA polymeraserecognises the transcription start site on the template strand of DNA with the help of certain specific regions on the DNA known as promoter elements. The sigma factor of RNA polymerase is especially crucial in recognises the promoter elements. There are two promoter elements regions identified in DNA:-
Soon after the binding of RNAP to the promoter element, the first nucleotide always a purine is inserted at the 5' end of the nascent RNA molecule and the RNAP moves next to the second base in the template. A phosphodiester bond forms with the second nucleotide base and the transcription is initiated. At this stage, the sigma factor of RNAP dissociates from the rest of the enzyme.
(6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start...
1. The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the -10 and the -35 sites and RNA polymerase plus sigma factor.
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
F) The transcription initiation site is located (3 pts) i) within the promoter. ii) on RNA polymerase. iii) at splice sites. iv) in a ribosome. v) all of the above
Prokaryotic transcription initiation occurs when RNA polymerase binds to promoter region. A hairpin loop is formed. Replication forks are created. DNA polymerase binds to promoter region. Flag this Question Question 8 2 pts The movement of genetic information between organisms is termed __________. genetic engineering. transfection. translocation. gene transfer. Flag this Question Question 9 2 pts Heterotrophs cannot synthesize organic molecules on their own. manufacture their own food. include two of the choices. include all the choices. can be chemoheterotrophs....
Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter TATA-Binding Protein (TBP) RNA polymerase + sigma factor enhancer TATA-box gene-specific transcription factors RNA polymerase + GTFs phosphodiester bonds -10 and -35 consensus sequences mediator protein +1 Transcriptional Start Site (TSS) deoxynucleoside triphosphates (dNTPs) template DNA RNA transcript.
Describe the process of Prokaryotic RNA transcription in molecular detail You must be able to describe the process and order of events in initiation, elongation, and termination. You must describe the catalytic/biological purpose function of the key proteins/elements in elongation -35 and -10 (Pribnow box) Promoters Sigma factors (does not matter which one) RNA Polymerase (including structure and subunits and mechanism) Rho-independent and rho-dependent termination How sequence composition affects promoter function
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...