Homework Answers
Solution
tRNA has a sequence of three nucleotides that called anticodon, which can bind to specific codons of mRNA.They pair with mRNA by way of an anticodon. And opposite side t-rna binds with a specific aminoacids that depends on reading on M-RNA.
Ans.1
tRNA read sequence is:- ACACUACUGCUUGCUCCCUGACU
ACA-CUA-CUG-CUU-GCU-CCC-UGA-CU
Ans.2
Aminoacids sequence is-
threonine-leucine-leucine-leucine-alanine-proline-stopcodon (no aminoacid)
stop codon is to stop a formation of polypeptide.
Add Answer to:
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid...
1. The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the...
1. The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the -10 and the -35 sites and RNA polymerase plus sigma factor.
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
12. For each of the following sequences, fill in the mRNA sequence, the tRNA anticodons, and...
12. For each of the following sequences, fill in the mRNA sequence, the tRNA anticodons, and the amino acid sequences. DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT AUG GLG mRNA tRNA AA DNA TAC TGA TCG ACC CCCATA ATG AAA ATC mRNA tRNA AA
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided....
Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided. Determine which amino acid is coded for and write its name next to the corresponding number below. ① START - methionine ⑤Click or tap here to enter text. ②Click or tap here to enter text. ⑥Click or tap here to enter text. ③Click or tap here to enter text. ⑦Click or tap here to enter text. ④Click or tap here to enter text. ⑧Click...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
A part of an mRNA molecule with the following sequence is being read by a ribosome:...
A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG-ACG 3 (mRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the mRNA so that a dipeptide can form. Table 17.1 RNA Anticodon Amino Acid GGC Proline Alanine UGC Threonine Glycine Cysteine CGG Alanine CGU CCG ACG What is the anticodon loop of the first tRNA that...
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False;...
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False; in translation codon nucleotides are bound directly to amino acids False; in translation nucleotides are matched by complementarity but amino acid sequence is unrelated True; codons matching anti-codons is the only process where complimentary nucleotides associate True; nucleotides on mRNA and on tRNA are complimentary (the operon and anti-codon) and the tRNA carries a single amino acid
A codon for the amino acid alanine is GCA. Therefore, the anticodon sequence on the tRNA...
A codon for the amino acid alanine is GCA. Therefore, the anticodon sequence on the tRNA that brings alanine to the ribosome will be: CGU ACG GCA TGC
What is the sequence of information transfer, as outlined by the central dogma? 1) DNA-> tRNA->mRNA->...
What is the sequence of information transfer, as outlined by the central dogma? 1) DNA-> tRNA->mRNA-> polypeptide 2) DNA-> mRNA-> tRNA-> polypeptide 3) DNA-> mRNA-> rRNA-> polypeptide 4) polypeptide-> rRNA-> tRNA->DNA 5) polypeptide-> tRNA-> mRNA-> DNA
1. The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the -10 and the -35 sites and RNA polymerase plus sigma factor.
12. For each of the following sequences, fill in the mRNA sequence, the tRNA anticodons, and the amino acid sequences. DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT AUG GLG mRNA tRNA AA DNA TAC TGA TCG ACC CCCATA ATG AAA ATC mRNA tRNA AA
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG-ACG 3 (mRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the mRNA so that a dipeptide can form. Table 17.1 RNA Anticodon Amino Acid GGC Proline Alanine UGC Threonine Glycine Cysteine CGG Alanine CGU CCG ACG What is the anticodon loop of the first tRNA that...
A codon for the amino acid alanine is GCA. Therefore, the anticodon sequence on the tRNA that brings alanine to the ribosome will be: CGU ACG GCA TGC
Most questions answered within 3 hours.
-
You are planning for retirement. You plan to work for 20 years.
Starting a year from...
asked 11 minutes ago -
The African Adventures exhibit water system holds approximately
850,000 gallons (3.2x109 g) of water. The temperature...
asked 3 minutes ago -
which of the following is capital?
the barn a farmer uses to hold the chickens he...
asked 13 minutes ago -
Attribute
Sample Value
Sample Value
Sample Value
Sample Value
pirate_num
11
22
43
54
pirate_lname
James...
asked 6 minutes ago -
10. Two forces act on a 3 kg object, the gravitational force and
a second, constant...
asked 24 minutes ago -
Dividing Partnership Net Loss
Leigh Meadows and Byron Leef formed a partnership in which the
partnership...
asked 20 minutes ago -
Discuss how Entrepreneurial leadership style differs
from traditional leadership?
asked 46 minutes ago -
A futuristic design for a car is to have a large solid
disk-shaped flywheel within the...
asked 44 minutes ago -
Solid NaOH is added to a solution of 0.50 M acetic acid until
the pH of...
asked 47 minutes ago -
Which of the following statements is not a characteristic of the
Internal Revenue Code?
A) The...
asked 55 minutes ago -
Say true or false and explain it.
A heap is represented using an array. The array...
asked 1 hour ago -
Explain how the DNA replication enzyme complex is organized and
functions, please don't copy paste from...
asked 1 hour ago