Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided. Determine which amino acid is coded for and write its name next to the corresponding number below.
① START - methionine |
⑤Click or tap here to enter text. |
②Click or tap here to enter text. |
⑥Click or tap here to enter text. |
③Click or tap here to enter text. |
⑦Click or tap here to enter text. |
④Click or tap here to enter text. |
⑧Click or tap here to enter text. |
Gene Template in DNA Triplets: |
T A C |
A C C |
G T G |
A A G |
C T A |
G T C |
T T C |
A C T |
|
Transcribe into mRNA codons |
A U G |
UGG |
CAC |
UUC |
GAU |
CAG |
AAG |
ACU |
|
Translate into tRNA anticodons |
U A C |
ACC |
GUG |
AAG |
CUA |
GUC |
UUC |
UGG |
|
Amino Acid # |
① |
② |
③ |
④ |
⑤ |
⑥ |
⑦ |
⑧ |
Gene Template in DNA Triplets: |
T A C |
A C C |
G T G |
A A G |
C T A |
G T C |
T T C |
A C T |
Transcribe into mRNA codons |
A U G |
UGG |
CAC |
UUC |
GAU |
CAG |
AAG |
ACU |
Translate into tRNA anticodons |
U A C |
ACC |
GUG |
AAG |
CUA |
GUC |
UUC |
UGG |
Amino Acid # |
Met |
Trp |
His |
Phe |
Asp |
Gln |
Lys Thr |
Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided....
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Refer to the diagram below. What amino acid will the tRNA carry, based on the anticodon? A 3' end cuucy 5' end G UUSUJUDOC UA GA CA C CU GUG D G CUCG GAGC a S GAG ncan anticodon loop AGC anticodon a Serine (UCG) b. Alanine (GCU) Valine (GUC) d. Leucine (CUG)
During elongation of proteins during protein synthesis tRNA with the amino acid that matches its anticodon binds to the codon on the mRNA. each new amino acid is first transferred to the anticodon of the tRNA. anticodons on the ribosomes recognize the codons on the mRNA and attach the correct amino acids. ribosomes move along the DNA. RNA polymerase II uses the codons on the mRNA to polymerize the protein.
Label the diagram. Use these choices: transfer RNA (TRNA), amino acid, amino acid chain, codon, anticodon, messenger RNA (MRNA), ribosome ©--[oop (2) GU View as Text >>
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...