Homework Answers
| 5' | TCT-GAA-ATG-TGA | 3' | Non-template strand |
| 3' | AGA-CTT-TAC-ACT | 5' | Template strand |
| 5' | UCU-GAA-AUG-UGA | 3' | mRNA |
| N terminal | Ser-Glu-Met-Stop | C terminal | Amino acid |
Add Answer to:
5' or or Using the codon table provided, fill in the missing entries in the following...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
Most questions answered within 3 hours.
-
1. Are all good samples random?
2. Magazines often report surveys giving statistics such as “63%...
asked 28 seconds from now -
Buying your in-laws a gift because it’s expected is
due to the ____________ motive of gift-giving....
asked 7 minutes ago -
Discuss the pros and cons of collaborative software such
as SameTime. Does it increase productivity? What...
asked 4 minutes ago -
A large cable company reports the following.
80% of its customers subscribe to its cable TV...
asked 6 minutes ago -
Calculate the expected value, the variance, and the standard
deviation of the given random variable X....
asked 50 minutes ago -
A hospital performs 100 surgeries per week. The probability that
complications after surgery occur is 10%....
asked 1 hour ago -
1 point) Given the significance level α=0.01 find the following:
(a) left-tailed z value z= (b)...
asked 48 minutes ago -
Assuming you are the head of the software development unit at
Cyber.Soft, explain and justify why...
asked 14 minutes ago -
Magnesium and nitrogen react in a combination reaction to
produce magnesium nitride. 3 Mg + N2...
asked 22 minutes ago -
Two electrons are initially at rest separated by a distance of
2nm. At time t=0, they...
asked 20 minutes ago -
A martial artist is practicing breaking 5 boards. He is able to
break aboard with probability...
asked 28 minutes ago -
The rate constant of a first-order reaction is 2.95 × 10−4 s−1
at 350.° C. If...
asked 31 minutes ago