True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence.
False; in translation codon nucleotides are bound directly to amino acids
False; in translation nucleotides are matched by complementarity but amino acid sequence is unrelated
True; codons matching anti-codons is the only process where complimentary nucleotides associate
True; nucleotides on mRNA and on tRNA are complimentary (the operon and anti-codon) and the tRNA carries a single amino acid
1. True
In translation the mRNA sequence is translated into the amino acid
sequence based on complimentary.
2. Fasle
The tRNA is directly binds with codon.
3. False
The amino acid sequence are based on mRNA or complemntary to
anticodon region.
4. True
5. True
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False;...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...
1) Answer True or False for each questions a) Each amino acid is coded by a single combination of three nucleotides. (T/F) b) Several amino acids can be coded by the same combination of three nucleotides. (T/F) c) Non-conventional nucleotides in anticodon can correspond to the first position of codon. (T/F) 2) For reading frames (potentially) for each RNA sequence, is it 1? I'm not sure if its one or three.
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
Polymerization of amino acids into a polypeptide requires energy. In terms of chemical thermodynamics, the chemical energy for peptide bond formation in translation technically comes from: hydrolysis of GTP hydrolysis of ATP translocation of the ribosome as it moves along the mRNA ribosomal RNA (rRNA) secondary structure transcription of the mRNA that is being translated Transfer RNA (tRNA) is a ribonucleic acid about 50-60 nucleotides long. When a tRNA gets "charged" by covalent addition of its cognate amino acid, to...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
Please use the drop down menu of answer choices to answer all questions. Reference both picturea for all possible answer choices. Thanks! 1. At this step in the process of translation the ribosome assemble around the mRNA 2 At this step in translation the tRNA takes amino acids to the ribosomes attached to mRNA_to build a polypeptide chain 3. At this step in translation the ribosome releases the polypeptide chain 4. True/False in prokaryotes translation takes place in the cytoplasm...
18. The job of the tRNA is to A. Bring the correct amino acid to the ribosome B. Ship the finished proteins to their proper locations in the cell C. Terminate the mRNA D. Transcribe the gene E. Transform the DNA 19.How many codons code for amino acids? A. 4 B. 16 C. 20 D. 61 E. 64 20. The process of translation A. Makes DNA B.Makes mRNA C. Makes new cells D. Makes protein E. Makes tRNA 21. During...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...