Question

25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3 end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of the following bases is used in RNA but not DNA? a. adenine b. thymine d. guanine c. uracil 29, What are the monomers of nucleic acids called? a. amino acids b. monosaccharides c carbon hat enzyme complex is responsible for DNA replicationi a. DNA polymerase b. RNA polymerase .hexokinase 31. What enzyme complex is responsible for transcription? a. DNA polymerase b. RNA polymerase , hexokinase 32. What is the molecule of inheritance? 30. W d. amylase d. amylase d. maltose c. protein a. DNA b. RNA 33. In which direction does RNA synthesis proceed? c. top to bottom d. 5 to 3 left to right b. 3 to 5 34. A tRNA in the P site of a ribosome is typically attached to a(n) d. none of the above b. polypeptide c. termination factor a. amino acid 5. Which of the following is NOT a stage of translation? a Initiation 36. The b. Expression c. Elongation d. Termination idea that different exons of the same gene can be bound together in different ways to create different proteins is called a. Alternative mRNA Splicing c. Post-translational control b. Endosymbiosis d. The Operon Model 37. What amino acid does the codon CUG code for? a. Arg b. Leu c. His d. Ser 38. What amino acid does the codon CAU code for? a. Arg b. Leu d. Ser C, His 39. What amino acid does the codon AGU code for? b. Leu c. His d. Ser 40. Which amino acid would most likely be attached to a tRNA with the anti-codon 5-UGA-3 A. Gin b. Leu d. None of the above c. Ser
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer 25

Termination factor is correct answer.

During termination of translation, termination factors binds to the stop codon resulting in the disassembly of translational machinery which results in the termination of translation.

Answer 26

Amino acid is correct answer.

Acceptor arm of tRNA is responsible for binding with amino acid, which will ultimately transferred to the translational machinery by tRNA and amino acid will get incorporated into the growing polypeptide.

Answer 27

Poly A tail is correct answer.

During post translational modification, poly A tail is attached to the 3' end of pre mRNA.

Answer 28

Uracil is correct answer.

Uracil is exclusively found in RNA.

Add a comment
Know the answer?
Add Answer to:
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Complete a concept map of translation, indicate where it takes place, and describe what will happen...

    Complete a concept map of translation, indicate where it takes place, and describe what will happen if the anticodon is not attached to transfer RNA. A)DNA unzips ?transcription of mRNA ? mRNA leaves nucleus ? mRNA binds to ?ribosome ? tRNA brings in amino acid? tRNA anticodon binds to codon on mRNA ? peptide bond binds amino acids to form protein ? transport of the amino acids to the mRNA by tRNA continues until the mRNA translation is completed. This...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • A r cted synthesis in the con rection direction 10.) What type of bond forms between...

    A r cted synthesis in the con rection direction 10.) What type of bond forms between complementary base pairs? a hydrophobic b. covalent conic d hydrogen 20 ) A particular triplet of bases in the template strand of DNA is 5-AGT-3'. What would be the corresponding codon for the mRNA that is transcribed? a. 3-UCA-5 b. 3-UGA-5 © CA-3 d. 3' ACU-5 21.) In eukaryotes, there are several different types of RNA polymerase. Which type is involved in the transcription...

  • 1a. During translation termination: a. a release factor with an anticodon complementary to the stop mRNA...

    1a. During translation termination: a. a release factor with an anticodon complementary to the stop mRNA codon bonds the A site b. Ribosomal complex dissociates releasing the mRNA c. all of the responses are correct. d. hydrolysis seperates the polypeptide from tRNA. --------------------------------------------------------------------------------------------------------------------------- 1b. Select the one NOT involved in the formation in the formation of a eukaryotic transcription initiation complex. a. spliceosome b. all are required c. RNA polymerase III d. transcription factors e. TATA box in a promoter...

  • 23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap...

    23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap of a properly modified mRNA B. transcription factors C. the anticodon of a properly formed aminoacyl tRNA D. the sequence of the coding strand E. all of the above 24. If the DNA code for a particular amino acid is 5'AGT3', then the anticodon on the tRNA would be A. 5'TCA3 B. 5'UCA3 C. 5'AGU3 D. 5'ACU3 E. 5'UCA3 25. What enzyme catalyzes the...

  • 1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA...

    1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis? a. It is at the end of a mRNA molecule and terminates translation once the protein is completed. b. It prematurely terminates protein synthesis resulting in an incomplete protein. c. The 3 stop codons are UGA, UAG, and UGG. 2. A tRNA with an ACC anticodon will insert the amino acid ________ during translation. (Use your codon sheet, Fig. 6...

  • Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and...

    Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...

  • When a stop codon is in place at the ribosomal A site, a ________________ factor binds...

    When a stop codon is in place at the ribosomal A site, a ________________ factor binds to the site instead of a new aminoacyl-tRNA. List two specific causes of DNA mutations. One of the ways chromatin remodeling occurs to allow gene expression is ____________________ of ______________ residues of histones. During translation, elongation factors EF-Tu and EF-G use hydrolysis of the energy molecule  ________ to successfully complete their tasks The __________________________________ sequence is a consensus sequence (in prokaryotic mRNAs only) that signals...

  • k. Define: codon, anti-codon, transcription, translation, redundancy 1. Is it the case that a small change...

    k. Define: codon, anti-codon, transcription, translation, redundancy 1. Is it the case that a small change in DNA will always impact the protein? Explain. m. What mechanism is in place that ensures the right amino acid is added to the polypeptide? (Think codon-anticodon interaction) n. What happens if the tRNA enters the ribosome and the codon and anticodon do not match up?

  • Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected...

    Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT