Answer 25
Termination factor is correct answer.
During termination of translation, termination factors binds to the stop codon resulting in the disassembly of translational machinery which results in the termination of translation.
Answer 26
Amino acid is correct answer.
Acceptor arm of tRNA is responsible for binding with amino acid, which will ultimately transferred to the translational machinery by tRNA and amino acid will get incorporated into the growing polypeptide.
Answer 27
Poly A tail is correct answer.
During post translational modification, poly A tail is attached to the 3' end of pre mRNA.
Answer 28
Uracil is correct answer.
Uracil is exclusively found in RNA.
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
Complete a concept map of translation, indicate where it takes place, and describe what will happen if the anticodon is not attached to transfer RNA. A)DNA unzips ?transcription of mRNA ? mRNA leaves nucleus ? mRNA binds to ?ribosome ? tRNA brings in amino acid? tRNA anticodon binds to codon on mRNA ? peptide bond binds amino acids to form protein ? transport of the amino acids to the mRNA by tRNA continues until the mRNA translation is completed. This...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
A r cted synthesis in the con rection direction 10.) What type of bond forms between complementary base pairs? a hydrophobic b. covalent conic d hydrogen 20 ) A particular triplet of bases in the template strand of DNA is 5-AGT-3'. What would be the corresponding codon for the mRNA that is transcribed? a. 3-UCA-5 b. 3-UGA-5 © CA-3 d. 3' ACU-5 21.) In eukaryotes, there are several different types of RNA polymerase. Which type is involved in the transcription...
1a. During translation termination: a. a release factor with an anticodon complementary to the stop mRNA codon bonds the A site b. Ribosomal complex dissociates releasing the mRNA c. all of the responses are correct. d. hydrolysis seperates the polypeptide from tRNA. --------------------------------------------------------------------------------------------------------------------------- 1b. Select the one NOT involved in the formation in the formation of a eukaryotic transcription initiation complex. a. spliceosome b. all are required c. RNA polymerase III d. transcription factors e. TATA box in a promoter...
23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap of a properly modified mRNA B. transcription factors C. the anticodon of a properly formed aminoacyl tRNA D. the sequence of the coding strand E. all of the above 24. If the DNA code for a particular amino acid is 5'AGT3', then the anticodon on the tRNA would be A. 5'TCA3 B. 5'UCA3 C. 5'AGU3 D. 5'ACU3 E. 5'UCA3 25. What enzyme catalyzes the...
1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis? a. It is at the end of a mRNA molecule and terminates translation once the protein is completed. b. It prematurely terminates protein synthesis resulting in an incomplete protein. c. The 3 stop codons are UGA, UAG, and UGG. 2. A tRNA with an ACC anticodon will insert the amino acid ________ during translation. (Use your codon sheet, Fig. 6...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
When a stop codon is in place at the ribosomal A site, a ________________ factor binds to the site instead of a new aminoacyl-tRNA. List two specific causes of DNA mutations. One of the ways chromatin remodeling occurs to allow gene expression is ____________________ of ______________ residues of histones. During translation, elongation factors EF-Tu and EF-G use hydrolysis of the energy molecule ________ to successfully complete their tasks The __________________________________ sequence is a consensus sequence (in prokaryotic mRNAs only) that signals...
k. Define: codon, anti-codon, transcription, translation, redundancy 1. Is it the case that a small change in DNA will always impact the protein? Explain. m. What mechanism is in place that ensures the right amino acid is added to the polypeptide? (Think codon-anticodon interaction) n. What happens if the tRNA enters the ribosome and the codon and anticodon do not match up?
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...