Homework Answers
23) E option is correct all the mentioned statements are correct for correct protein synthesia
24) C option correct as '5 AGT3' present on DNA then on tRNA 5' AGU3'
25 D option is correct
26) A option is correct templete strand
27) B option correct S phase
28) D option is correct ..CUG
Hope it's clear..thanks
Add Answer to:
23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
Question 3 (4 pts): The following table provides just enough information about a section of a...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
1.) In which direction is RNA transcribed? 2.) Which of the two strands (A or...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Complete a concept map of translation, indicate where it takes place, and describe what will happen...
Complete a concept map of translation, indicate where it takes place, and describe what will happen if the anticodon is not attached to transfer RNA. A)DNA unzips ?transcription of mRNA ? mRNA leaves nucleus ? mRNA binds to ?ribosome ? tRNA brings in amino acid? tRNA anticodon binds to codon on mRNA ? peptide bond binds amino acids to form protein ? transport of the amino acids to the mRNA by tRNA continues until the mRNA translation is completed. This...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
“Unlike what happens in DNA replication, where both strands are copied, only one of the two...
“Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Most questions answered within 3 hours.
-
what is the name of the uppermost rock unit "formation" that
underlies Saginaw, mi? This assignment...
asked 2 minutes ago -
What is a good infrastructure recommendation for communications
networks in Hong Kong?
asked 3 minutes ago -
A string is wrapped around a drum that has a radius of 3 cm. If
a...
asked 10 minutes ago -
what applied force is needed to accelerate 50kg at 2m/s^2 if
the friction force is 200
asked 14 minutes ago -
A survey found that the American family generates an average of
17.2 pounds of glass garbage...
asked 22 minutes ago -
Help Please!
Runyan voluntarily petitions for bankruptcy. He has three major
claims against his estate. One...
asked 16 minutes ago -
Key Themes for the study of Islam
Chapter 9: God
In 833 CE, the caliph Al-Ma'mun...
asked 23 minutes ago -
Please, i need Unique answer, Use your own words (don't copy and
paste). *Please, don't use...
asked 46 minutes ago -
In 2018 Lamborghini was quite concerned with pricing the new
Lambo, the Lambo Centenario. The manager...
asked 30 minutes ago -
If someone could solve this and explain how they did so that
would be great.
I...
asked 45 minutes ago -
What would be the formal charge on the nitrogen atom in a
compound that had a...
asked 46 minutes ago -
How is an organization's culture learned? How are the
mores and folkways of the organization passed...
asked 45 minutes ago