Question


Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Am
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans19)a)Codons

Explaination:The three letter code words of DNA and mRNA that specify amino acids are called codon.

Promoters are the sequences of DNA where RNA polymerase binds and initiate the transcription of a gene.

Introns are the non coding sequences of a gene.

Anticodons are the three letter code of tRNA that are complementary to codon of mRNA.

Ans20)C)Amino acids.

Explaination:Proteins are polymer of amino acids so the building block of proteins are amino acid.

Fatty acid are monomer units of lipids .

Nucleotides are monomer of nucleic acids ie, DNA and RNA

Phosholipids are type of lipids that are consist of 2 hydrophobic  fatty acid tails and a hydrophilic phosphate head.

Ans21)A)mRNA molecule

Explaination:Transcription is the process of synthesis of mRNA in the nucleus using DNA as template.

Translation is the process of synthesis of proteins or polypeptides.

Replication of a gene or DNA sequence to produce DNA copy.

Gametes are produced by the process gametogenesis.

Ans22)B)Protein

Explaination:Translation is the mechanism or process in which coded language of mRNA changes to the actual polypeptide chain. It occurs on ribosome.

Ans23)C)tRNA. ... mRNA.

Explaination:The tRNA contains three unpaired nitrogen bases called anticodon that are complementary to the  triplet codon of mRNA and and function of tRNA is to bringing proper amino acid at correct position during protein synthesis when anticodon on tRNA binds with the complementary  codons on mRNA.

Ans24)c)at the ribosomes.

Explaination: Ribosome is the site of protein synthesis (translation ).

Ans25)b)tRNA

Explaination:tRNA are loop like molecules that bind or link to amino acid and bring or taxi them to the ribosome where they are linked together to bulid a polypeptide.

During protein synthesis the major function of tRNA is to transfer amino acid from cytoplasm to the site of protein synthesis ie, ribosome.

Add a comment
Know the answer?
Add Answer to:
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...

    c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • 2. For the following short segment of a DNA strand, complete the following table. The codon...

    2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page. Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...

  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

  • 1. A is a unit of nucleic Select the appropriate term from the table below to...

    1. A is a unit of nucleic Select the appropriate term from the table below to complete eacALUlllllell. tRNA rRNA replication transcription translation DNA. deletion translocation frame shift nucleus a l. A Duckohde unit of nucleic acid containing a sugar attached to is a phosphate group and a base. 2. The site of transcription is the the ribosome moves along the mRNA. 3. In the process of 4. A class of RNA molecules which is linked directly with protein synthesis,...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions...

    EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...

  • Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA,...

    Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA, polypeptide chains c) mRNA, tRNA, polypeptide chains d) rRNA, tRNA, amino acids Teacher says a is wrong

  • Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...

    Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT