Question

Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication
Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone »oclamac Third letter
Provided DNA Sequence from instructor. 5-CTGAGCAGGTGGGCCGAC-3 FILL IN THE CHART BELOW Transcription and Translation Column
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The given DNA strand is 5' to 3' is a non template strand . It is also called sense strand or coding strand

Step 1 : Replication (nucleous)

we have to write (make) the complimantry strand of given DNA . ie 3' to 5' STRAND .

it will serve as the template strand for mRNA synthesis. base pairs A-T, G-C

Step 2: Transcription (nucleous)

write the mRNA sequence using the template strand. In RNA, nucleotide Uracil replaces Thymine

so base pairs are A-U, G-C. (the formed m RNA template will be same as 5' to 3' strand replacing Thymine)

Step 3: Translation (cytoplasam)

A combination of 3 Nucleotides form the Codon. Each codon code for a specific amino acid.

Strat codon : AUG code for methionine, Stop codon are : UAA, UAG,UGA

Specific amino acids for each codon can be found out from universal table provided.

Given DNA : 5' C T G A G C A G G T G G G C C G A C 3'

New DNA : 3' G A C T C G T C C A C C C G G C T G 5'

mRNA: C U G A G C A G G U G G G C C G A C

| | | | | |

Lucine  Serine Arginine Tryptophan Alanine Aspartate

table below

Add a comment
Know the answer?
Add Answer to:
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use the provided DNA sequence to generate an amino acid sequence

    > Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA > Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead  of T > Translation: use the genetic code to determine the amino acid sequence

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication

    Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...

  • A strand of DNA has the base sequence GATTCA

    3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are...

    Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are these? How do you do the bottom?   Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...

  • Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...

    Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...

  • Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of...

    Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of DNA, mRNA, TRNA and/or polypeptide (AA : amino acids). Remember A codon chart can only be used for decoding a strand of mRNA Codon Chart a THrd DNA: TAC GCG CCT AGG 6GG TGG mRNA: DNA: TTC GAT TAG ATG CCG AAG mRNA: tRNA: - - DNA: mRNA:

  • Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C...

    Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C A   C   C   G   G   T   C   A   G   G   T   G A   T   C -5’ A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points) B. Now imagine that the new strand...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT