Question

DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest F
Procedure - Practicing DNA Replication 1 Recall the complementary base pairing rules that A pairs with and pairs with G. 2. U
THE CENTRAL DOGMA: GENE E Sequence of bases in DNA forms a code, or set of instruc c ids. These pre om the Biological Molecul
Transcription: DNA mRNA is transcription, the nucleotide base sequence in DNA is used to synthesize messenger RNA (MENA which
Translation: mRNA Protein Once in the cytoplasm RNA attaches to a ribosome, where trans Franslation is the conversion of the
How Can a Mutation in DNA Affect an Organism? stains an error sometimes the DNA code that makes up agere contains an error ca
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Table 8.1 - DNA replication data:

  8.2: Transcription & Template DNA TMRNA Transh T Amuid- UGG suu555 1 255 vou ccc 8.3. Section code for. normal Haemoglobin Se

Explanation: basics of molecular biology explains that

Adenine -thymine

Guanine - cytosine

Are the purine pyramidines base pairs in DNA

# in case of RNA

Adenine- uracil

Guanine - cytosine

Add a comment
Know the answer?
Add Answer to:
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication

    Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...

  • Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...

    Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...

  • QUESTIONS During replication the protein that keeps the two stands of DNA from popping back together...

    QUESTIONS During replication the protein that keeps the two stands of DNA from popping back together is called Gene Semiconservative SSB Single Stranded Binding Protein ODNA polymerase QUESTION 2 Tachnow molecule of DNA is a double he which is made up of O two new stands of DNA one new strand and one old strand of DNA two old stands of DNA o the new strands of DNA QUESTIONS QUESTION 19 The process of synthesizing RNA from a specific sequence...

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...

    One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...

  • 1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication...

    1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication of the lagging strand is discontinuous B. Transcription factors DNA replication of the lagging strand is continuous C. Helicases D. Histones E. DICER 2. Which of the following statements is true? A. DNA replication of the leading strand is discontinuous B. DNA replication of the lagging strand is discontinuous C. DNA replication of the leading strand is dispersive D. DNA replication of the lagging...

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think...

    Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think carefully about this answer! The question in my presentation had a mistake. DNA poll replaces the RNA primer at the 5' end of the new strand with DNA. DNA poll replaces the RNA primer at the 3' end of the new strand with DNA. None of the above Question 4 1 pts Telomerase works by Elongating the 5' to 3' newly replicated DNA strand...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT