What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
The given sequence of mRNA is
The first 3 letters represent the codon AUG, which is the start codon and codes for the amino acid Met(Methionine).
Hence, the first amino acid in the sequence is Met.
The next 3 letter codon is AAC. It codes for the amino acid Asn(Asparagine).
Hence, the second amino acid in the sequence is Asn.
The next three letter code is CUA. It codes for Leu (Leucine).
Hence, the third amino acid in the sequence is Leu.
The next three letter code is UGC. It codes for Cys(Cysteine).
Hence, the last amino acid in the sequence is Cys.
Hence, the amino acid sequence coded by the given mRNA is Met-Asn-Leu-Cys.
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence (1-letter abbreviations) Do not separate abreviations with hyphens.) Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence...
Suppose part of the amino acid sequence of a protein is N... Gly - Ala - Pro - Arg - Lys ...C. Which of the following amino acid sequences could result from a frameshift mutation (+1 or -1) in the part of the gene that encodes this sequence of amino acids? Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
anyone can help me with it? A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotrypsin, and cyanogen bromide treatments to suggest the amino acid sequence of this decapeptide. Trypsin digestion gave two fragments with multiple residues (not in order): • T1: Ala, Arg, Phe, Gly, Thr, Trp, Tyr • T2: Lys, Met, Val Chymotrypsin digestion gave four fragments with multiple residues (not in order): • CT1: Ala, Phe •...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Which amino acids does the below DNA sequence encode for? 5-ATGCCATGG-3 3'-TACGGTACC-5 O Met-Pro-STOP Tyr-Gly-Ser Met-Pro-Trp Tyr-Gly-Thr Met-Pro-Tyr