Question

Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation End of leader region (trpl)

Answer 1

The tryptophan operon system codes for the essential aminoacid tryptophan. The tryptophan operon is present in many bacteria.The operon is regulated so that when tryptophan is present in the environment, the genes for tryptophan synthesis are not expressed.

Trp operon contains five structural genes: trpE, trpD, trpC, trpB, and trpA, It also contains a repressive regulator gene called trpR. trpR has a promoter where RNA polymerase binds and synthesizes mRNA for a regulatory protein. The protein that is synthesized by trpR then binds to the operator which then causes the transcription to be blocked. In the trp operon, tryptophan binds to the repressor protein effectively blocking gene transcription. In this situation, repression is that of RNA polymerase transcribing the genes in the operon.

;

Attenuator tp trpR trp trpP I r trpe . trob trp trpc trpc trpi troB trpa -23 trol

Attenuation regulates the expression of trp operon in E.coli controlling the expression of tryptophan. The tryptophan operon is regulated by the repressor which when bounds to the operator blocks the synthesis of the amino acid. If the tryptophan is abundant the operon shuts down as the body of E.coli has enough amount of tryptophan but if there is scarcity of the tryptophan the operon system is in the ON state in the prokaryotic body and the mechanism of synthesis is turned on.

The mechanism of attenuation depends on the fact that translation in bacteria is coupled with transcription. Transcription termination depends on the hair pin loop structure that is formed by the complementary base pairing. This structure forms if the amino acid is present in enough amount the the process is to be halted.

TThis happens only in prokaryotes as the eukaryotes have each gene which is made of own individual RNA and each each gene has its own promoter.

Tuesday 2 Wednesday 3 Thursday 4 Friday 5 Saturday 6 Sunday 7 10 11 12 13 14 Week 43 2 Wednesday (295-083) X No 8.00 22 October 2. High 900 tryptophan Growing u 8.30 traus chain 9.00 cription 9.30 10.00 TUUUN 10.30 RNAL 11.30 12.00 12.00 Case 1: 12.30 halts 13.00 - - 13.30 Mechanism of synthesis Lowtryptophan 2 14.00 14.30 Datas 15.00 3 Transcriptions 15.30 continues 16.00 16.30 17.0RW 17.07 17.30 18.00 Evening Case 2: Mechanism of - synthesis continues Meetings Things To Do ✓ Important Calls