Draw a diagrammatic interpretation of RNA polymerase pausing, antitermination, and attenuation that incorporates the mRNA, ribosome,...
Draw a diagrammatic interpretation of RNA polymerase pausing, antitermination, and attenuation that incorporates the mRNA, ribosome, tryptophan, and trp-tRNA levels and how these lead to each step (i.e., pausing, antitermination, and attenuation) occurring in the leader region of the trp operon.
Homework Answers
Add Answer to:
Draw a diagrammatic interpretation of RNA polymerase pausing,
antitermination, and attenuation that incorporates the mRNA,
ribosome,...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Prepare two diagrams illustrating the tryptophan operon attenuation mechanism. One diagram should be for the condition...
Prepare two diagrams illustrating the tryptophan operon attenuation mechanism. One diagram should be for the condition of low tryptophan concentration and the other for high tryptophan concentration. Write at least two sentences for each of the two diagrams that explains how attenuation allows bacteria to control the level of tryptophan. Provide the following labels on the diagrams to support your explanation: DNA, mRNA, polypeptide, RNA polymerase, ribosome, tryptophan codons, mRNA region #1, mRNA region #2, mRNA region #3, mRNA region...
Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that...
Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that would promote read-through (i.e. attenuation does not occur). Describe what is happening in the figure below, and how this corresponds to levels of tryptophan in the .cell (2 pts). RNA polymerase DNA Completed MKAIFVLKG leader peptide MU096 Ribosome mRNA 5 Attenuator structure Trp codons
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan...
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan codons, then O RNA polymerase will stop transcription of the trp operon 02. genes for cell dormancy are induced 3. the entire trp operon will be transcribed into mRNA. .4 the only peptide from the trp operon that will be produced is the leader peptide
a) For the lac operon, will the repressor or RNA polymerase be bound to the operon in this situation? Draw what wil...
a) For the lac operon, will the repressor or RNA polymerase be bound to the operon in this situation? Draw what will be happening on the operon below. PROMOTER OPERATOR Lactose Enzyme 1 Lsctose Enzyme2 Lactose Enzyme 3 NO b) Will transcription occur? c) Describe what is happening (with vocabulary words). YES 2. Bobby Joe is fasting today, how will the E. coli in her stomach respond to the lack of Tryptophan? a) For the trp operon, will the repressor...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected...
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
-Stages of transcription (in detail for each step) - what components are required -Modifications of RNA...
-Stages of transcription (in detail for each step) - what components are required -Modifications of RNA (on the ends of mRNA, on the interior of mRNA) -why are these modifications important? -Ways to cut out introns (i.e. Splicesomes) -Alternative splicing Translation -TRNA structure and function -What controls accurate translation -wobble effect of tRNAS -general concept of how translation works using mRNA, ribosome, anticodon, tRNA -3 stages of translation (in detail) -initiation -elongation -termination
1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the...
1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the two tryptophan codons that are involved in attenuation. Predict the effect of this mutation on the expression of the trp structural genes in E. coli cells grown in media that lacks tryptophan. 2. (2 points) What protein family members are the main protein components of the RISC complex? How does the RISC complex target specific mRNAs for silencing? 3. (3 points) In bacteria, the...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that would promote read-through (i.e. attenuation does not occur). Describe what is happening in the figure below, and how this corresponds to levels of tryptophan in the .cell (2 pts). RNA polymerase DNA Completed MKAIFVLKG leader peptide MU096 Ribosome mRNA 5 Attenuator structure Trp codons
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan codons, then O RNA polymerase will stop transcription of the trp operon 02. genes for cell dormancy are induced 3. the entire trp operon will be transcribed into mRNA. .4 the only peptide from the trp operon that will be produced is the leader peptide
a) For the lac operon, will the repressor or RNA polymerase be bound to the operon in this situation? Draw what will be happening on the operon below. PROMOTER OPERATOR Lactose Enzyme 1 Lsctose Enzyme2 Lactose Enzyme 3 NO b) Will transcription occur? c) Describe what is happening (with vocabulary words). YES 2. Bobby Joe is fasting today, how will the E. coli in her stomach respond to the lack of Tryptophan? a) For the trp operon, will the repressor...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
-Stages of transcription (in detail for each step) - what components are required -Modifications of RNA (on the ends of mRNA, on the interior of mRNA) -why are these modifications important? -Ways to cut out introns (i.e. Splicesomes) -Alternative splicing Translation -TRNA structure and function -What controls accurate translation -wobble effect of tRNAS -general concept of how translation works using mRNA, ribosome, anticodon, tRNA -3 stages of translation (in detail) -initiation -elongation -termination
Most questions answered within 3 hours.
-
The outstanding bonds of Alpha Extracts have a yield to maturity
of 7.4 percent and a...
asked 17 minutes ago -
A 8.15- g bullet from a 9-mm pistol has a velocity of 366.0 m/s.
It strikes...
asked 21 minutes ago -
The Problem: The Case of the Harmonizing Vacations
Your CEO is exploring partnering with a European...
asked 1 hour ago -
A chemical equation is balanced by adding coefficients in front
of some formulas so that the...
asked 1 hour ago -
From the literature (reference your sources): What are the
lattice parameters of calcite and aragonite? Why...
asked 2 hours ago -
Your system is rejecting the question am asking which is
preceded by a case study. It...
asked 2 hours ago -
3. On January 2, 2000, Larry creates a trust with himself as
trustee. Larry as trustee...
asked 2 hours ago -
A member of the volleyball team spikes the ball. During this
process, she changes the velocity...
asked 2 hours ago -
Are adult gamers less likely to use a gaming console (Xbox,
PlayStation, Wii, etc...) than teen...
asked 3 hours ago -
The University of
Texas recently reported that 43% of college students aged 18-24
would spend their...
asked 3 hours ago -
The length of stay at a specific emergency department in
Phoenix, Arizona, in 2009 had a...
asked 2 hours ago -
. Please give the mechanism for this type of problem. Step by
Step
The toxin that...
asked 2 hours ago