Initiator met-tRNA will bind to small ribosomal subunit and scan for start codon Arginine and bind to AUG start codon and then large ribosomal subunit binds to it. After AUG, CGU codon is there which codes for arginine. Therefore, this arg-tRNA will come to the A- site of the ribosome.
So, Correct Option is Arginine
The piece of eukaryotic mRNA below includes the region that codes for the binding site for...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
For 4F5S in RCSB PDB websiteWhich amino acids comprise the binding site for PGE A 601? Select all that apply ValAspTrplleSerGlyPheHisProLeuLysCysAlaAsnMetTyrThreGurArgGin
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of cDNA that encodes the peptide KIGDACF? You must show your work. The Genetic Code с Т А Т UUU Phe (F) UCU Ser (S) UAU Tyr ( Y UGU Cys (C) UUC - UCC UAC. UGC. UUA Leu (L) UCA UAA Stop UGA Stop UUG- UCG UAG Stop UGG Trp (W) CUU Lệu U CCU Pro (P) CAU His (H) CGU Arg (R) CUC...
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia UA Tyrosine (Tyr) UAA Stop codon WA G Stop codon Yad Cysteine (Cys) (UGTA Stop codon (WE ) Tryptophan (Tip) MUG Leucine (Leu) CES Prol CA Histidine (is) EAG Gutamine (G) Arginine (Arg) First base Third base AAAsparagine AAC (Asn) soleucine (llo) Methionine (Met) IACA start codon Threonine (Thr) AG Serine (Ser) AG Arginine (Arg) AUG AAA Lysine (Lys) SAU Aspartic acid GAC (Asp)...