Homework Answers
The process of converting the genetic information in the mRNA strand to the form of protein is called translation.Codon is the basic unit of genetic information and it is the sequence of three nucleoside . These sequence is specific for each amino acid. . Transfer RNA (tRNA) act as interpreter between codons and amino acids during translation process.
An anticodon is a trinucleotide sequence which s complimentary to the corresponding mRNA codon. This is found at end of transfer RNA.
In the given question 5GGC3 is the anticodon, so the codon will be CCG, Hence proline is the correct answer.
Add Answer to:
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5...
To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5 pts 68a. Transcribe the mRNA molecule resulting from the following template DNA 33761 GTC-TAC-GCA-CTT-GGT-GCT-AGC-CTA-ACT-GAA-TCC 3761 - April Enter answer... -761 69. I 11 Second base of RNA codon +63 UUU UUC UGU _ Phenylalanine Phel VUA Serine Ser) UU LAC UAA UAG Tyrosine (Tyr) Stop Stop UUG Leul COU CAU UGC UGA Stop UGG Tryptophan (Top) CGU CGC Arginine CGA CGG Histidine CACH Proline...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
i think it might be Glutamate, but im not sure. Someone please help!! its the last...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when...
Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when the mRNA is AUGAUUGACUGA. Tyrosine – threonine – valine – glutamic acid Methionine - STOP Methionine – isoleucine – aspartic acid – STOP Lysine – arginine – glycine - STOP
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5 pts 68a. Transcribe the mRNA molecule resulting from the following template DNA 33761 GTC-TAC-GCA-CTT-GGT-GCT-AGC-CTA-ACT-GAA-TCC 3761 - April Enter answer... -761 69. I 11 Second base of RNA codon +63 UUU UUC UGU _ Phenylalanine Phel VUA Serine Ser) UU LAC UAA UAG Tyrosine (Tyr) Stop Stop UUG Leul COU CAU UGC UGA Stop UGG Tryptophan (Top) CGU CGC Arginine CGA CGG Histidine CACH Proline...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Most questions answered within 3 hours.
-
The denaturation of proteins can be described by the
equilibrium
F⇌U
where F and U represent...
asked 1 hour ago -
Please answer what the maximum and minimum force is, and the
angle on the ion is...
asked 1 hour ago -
implement a program that reads a number of rows and a symbol.
The program will draw...
asked 1 hour ago -
Assume that when adults with smartphones are randomly selected,
45% use them in meetings or classes....
asked 1 hour ago -
Determine the number of formula units of
Na2SO4 and moles of oxygen contained in 8.11
moles...
asked 1 hour ago -
Explain in steps on the following code
What would be the output when executed
using System;...
asked 1 hour ago -
Given the information in the table, which of the following
statements is CORRECT?
Stock A
Stock...
asked 1 hour ago -
Write MARIE assembly language programs that do the following:
Write a program that inputs an integer...
asked 1 hour ago -
Explain an understanding of services and protocols.
Explain the job of DNS.
Explain the three email...
asked 2 hours ago -
(As soon as possible) Balance each of the following equations
according to the half-reaction method:
H2O2(aq)...
asked 2 hours ago -
A thin rod with a mass of 3.5kg and a length L=1.5 m is oriented
horizontally....
asked 2 hours ago -
Inheritance pattern in BRCA 1
Describe the inheritance pattern of BRCA 1 Is it recessive or...
asked 2 hours ago