Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when...
Question 6
-
Using the provided Genetic Code, determine the amino acid sequence of a protein when the mRNA is AUGAUUGACUGA.
Tyrosine – threonine – valine – glutamic acid
Methionine - STOP
Methionine – isoleucine – aspartic acid – STOP
Lysine – arginine – glycine - STOP
Homework Answers
Using the provided genetic code answer for the sequence
AUGAUUGACUGA is step by step
AUG - Methionine
AUU - Isoleucine
GAC - Aspartic acid
UGA - Stop
So the answe for the question is -
Methionine - Isoleucine - Aspartic acid - STOP
Add Answer to:
Question 6
Using the provided
Genetic Code, determine the amino acid sequence of a protein when...
You are given the below piece of Template DNA. What is the third amino acid in...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
You are given the below piece of Template DNA (the same as the previous question). How...
You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с...
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in pr...
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
Most questions answered within 3 hours.
-
The University of
Texas recently reported that 43% of college students aged 18-24
would spend their...
asked 55 minutes ago -
The length of stay at a specific emergency department in
Phoenix, Arizona, in 2009 had a...
asked 11 minutes ago -
. Please give the mechanism for this type of problem. Step by
Step
The toxin that...
asked 15 minutes ago -
If you have a 1M stock solution and you want to dilute 1 :10
with water,...
asked 17 minutes ago -
In a load instruction, the effective address is obtained by
A) Retriving the address from a...
asked 17 minutes ago -
Use the following information to answer this question.
Windswept, Inc. 2017 Income Statement ($ in millions)...
asked 18 minutes ago -
A mutual fund salesperson has arranged to call on four people
tomorrow. Based on past experience...
asked 51 minutes ago -
Let the RV Y has the pdf
f ( y ) = 6 y ( 1...
asked 1 hour ago -
Question 12
Where should a copy of a private key should be placed so it is...
asked 20 minutes ago -
What is the entropy change to the surroundings when 1 mol of ice
melts in someone's...
asked 39 minutes ago -
Pt1
An electrochemical cell is set up at 25°C based on the overall
reaction represented by...
asked 45 minutes ago -
Explain traveling wave theory. Explain how the peaking of the
wave leads to action potentials and...
asked 36 minutes ago