Homework Answers
Template DNA:
3' AATACGGGGAGCTTTACAGAATTCAAATCA 5'
mRNA: synthesized from template strand of DNA from 5' - 3'.
5' UUAUGCCCCUCGAAAUGUCUUAAGUUUAGU 5'
Three nucleotides of mRNA makes a single codon of a gene and code of single amino acid.
5' Leu-Cys-Pro-Ser-Lys-Cys-Leu-Lys-Phe-Ser 3'
As per the table given, codons responsible for amino acids are given. 30 nucleotides code for 10 amino acids. Hence correct option is 10 amino acids.
Add Answer to:
You are given the below piece of Template DNA (the same as the previous question). How...
You are given the below piece of Template DNA. What is the third amino acid in...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5'...
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in pr...
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
Most questions answered within 3 hours.
-
The approved‐supplier list represents a major security
precaution that is popular among large hospitality companies.
Explain...
asked 18 seconds from now -
-Match the charge on phenylalanine at different pH:
1) pH=1
2) physiological pH
3) pH=10
a)...
asked 20 minutes ago -
Suppose the space shuttle is in orbit 500 km from the Earth's
surface, and circles the...
asked 15 minutes ago -
Heroux Corporation has two manufacturing departments--Forming
and Customizing. The company used the following data at the...
asked 12 minutes ago -
Select the correct statement(s):
1)Exceptions are compiler errors
2) Exceptions can be thrown from a method....
asked 16 minutes ago -
Please answer the questions from the field of genetics, in
words, and in detail.
1. What...
asked 19 minutes ago -
Assume that Earth's orbit around the Sun is a perfect circle.
Earth's inertia is 5.97×1024kg, the...
asked 34 minutes ago -
Alliance Company's budgets production of 28,000 units in January
and 32,000 units in February. Each finished...
asked 33 minutes ago -
You want to estimate the population mean by taking a sample and
constructing a 80% confidence...
asked 40 minutes ago -
You are working for a company that produces clones of famous
name wireless radio nannies. Your...
asked 43 minutes ago -
Human energetic status affects which of the following aspects of
women's reproductive physiology?
Question options:
hormonal...
asked 44 minutes ago -
The following mechanism has been proposed for the gas-phase
reaction of chloroform (CHCl3) and chlorine.
Cl2...
asked 45 minutes ago