ZuoTi.Pro
Question

Please answer the below genetics question and show/explain all work.

3. A Xenopus chromosome has a regular gene sequence of LMN*OPQRST. The centromere here is labeled with an *. You study Xenopus with the chromosomes listed below; you task is to label each of these chromosomes with the type of large-scale chromosomal rearrangement that has been made. A. LMN OROPST B. LMN OQRST C. LQPO* NMRST D. LMN*OPOABCD

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Answer:

A). LMN*ORQPST---Paracentric inversion (does not include centromere)

B). LMN*OQRST---Deletion

C). LQPO*NMRST---Pericentric inversion (includes centromere)

D). LMN*OPQABCD---Translocation

0 0
Add a comment
Know the answer?
Add Answer to:
Please answer the below genetics question and show/explain all work. 3. A Xenopus chromosome has a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Please answer #22-24, explain & clearly indicate which # you are answering. Thank you in advance!...

    Please answer #22-24, explain & clearly indicate which # you are answering. Thank you in advance! (Q22-24) A normal chromosome has the following gene sequence. The o indicates a centromere of this chromosome. Normal Chromosomes: AB o CDEFGH I o JKLMN Var.1: Var.2: Var 3: Var.4: AEDC o BFGH AB o CDEFH I o JNKLMN Io JMLKN and duplication is Deletion is Varl, Var 3 Varl, Var 2 Var3, Var 2 Var2, Var 3 Var4, Var 1 D) 23. and...

  • Please answer #22-24, explain & clearly indicate which # you are answering. Thank you in advance!...

    Please answer #22-24, explain & clearly indicate which # you are answering. Thank you in advance! (Q22-24) A normal chromosome has the following gene sequence. The o indicates a centromere of this chromosome. Normal Chromosomes: AB o CDEFGH I o JKLMN Var.1: Var.2: Var 3: Var.4: AEDC o BFGH AB o CDEFH I o JNKLMN Io JMLKN and duplication is Deletion is Varl, Var 3 Varl, Var 2 Var3, Var 2 Var2, Var 3 Var4, Var 1 D) 23. and...

  • Please answer the below genetics question and show/explain all work. 4. You've recently discovered the sequences...

    Please answer the below genetics question and show/explain all work. 4. You've recently discovered the sequences for two alleles for the mouse gene XCD, which you have creatively named XCD and XCD2. This gene is believed to be involved in fat metabolism, somehow, but you haven't successfully been able to isolate the protein yet. You've also noticed that your mutant grey coat mice tend to be much leaner and muscular than those with the standard white coat. So for your...

  • Advanced Genetics Problem: Yeast chromosome 3 has these genes in this order: HIS4 LYS1 URA3 ADE2....

    Advanced Genetics Problem: Yeast chromosome 3 has these genes in this order: HIS4 LYS1 URA3 ADE2. You have created a diploid strain of this genotype: You sporulate the diploid and analyze tetrads. Most tetrads show 2:2 segregation for all markers and recombination frequencies that are consistent with the established genetic map. However, you notice the one strange tetrad indicated below: Your goal is to explain how the genotypes of this tetrad arose during meiosis: a. Do these spores indicate that...

  • **Please answer ALL 10 QUESTION** 1. A species of flowering plant includes plants with blooms that...

    **Please answer ALL 10 QUESTION** 1. A species of flowering plant includes plants with blooms that range from bright golden yellow to very pale yellow; no flowers carrying the yellow pigment allele appear white. The allele for yellow flower color: a. must be a suppressor of another allele. b. demonstrates incomplete penetrance. c. demonstrates variable expressivity. d. must be a modifier of another allele. e. demonstrates variable penetrance. 2. Coat color in mice is determined by two alleles acting at...

  • can you please answer all the questions Gene therapy can best be described as the OA....

    can you please answer all the questions Gene therapy can best be described as the OA. repair of a defect (mutation) in a gene B. insertion of normal genes to act in place of mutant genes Oc. insertion of human genes into other organisms D. cloning of genes to produce and purify therapeutically useful proteins E. mapping of all human genetic information Donot Selection Transmission genetics A. uses recombinant DNA technology to identify, isolate, and produce millions of copies of...

  • Instructions Below is a picture of George's chromosomes (a hypothetical example). They show his genotypes for...

    Instructions Below is a picture of George's chromosomes (a hypothetical example). They show his genotypes for Cystic Fibrosis (Cc), ear attachment (ee), tongue rolling (Tt), and polydactyly (Pp) Mand Drepresents the chromosomes he inherited from Mom and Dad, and the number indicates which chromosome the genes for the above traits are on. Chromosome 1 Chromosome 2 Chromosome 3 M3 D3 M1 D1 M2 D2 T It C P p e In the following activity you will draw pictures of George's...

  • Please answer all of the following questions and show all work if needed please. You are...

    Please answer all of the following questions and show all work if needed please. You are interested in understanding the genomics of skin anatomy of the goblins that live under your stairs (hal), in particular you are interested in the linkage between the genes that control skin coloration (green), degree of hairness (hairy), and presence of copious amounts of warts (warty) You've determined the distance between the genes (see table below) Distance between Genes compared the loci green-hairy hairy-warty 9.2...

  • 5. Quantitative trait loci(QTL) are: The loci that contribute all of the variation in a continuous...

    5. Quantitative trait loci(QTL) are: The loci that contribute all of the variation in a continuous trait The loci that contribute all of the genetic variation in a continuous trait The loci that contribute the broad-sense heritability in a continuous trait The loci that contribute the narrow-sense heritability in a continuous trait 6. We looked at a study where Drosophila flies were selected for phototaxis (either attracted to or repelled by light). This experiment measures how much genetic variation existed...

  • For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a...

    For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT