Homework Answers
Add Answer to:
Given the following diagram of a typical eukaryotic coding gene, draw a basic sketch showing gene...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
answer parts e, f, and g 4. Look at the following diagram of a eukaryotic gene...
answer parts e, f, and g
4. Look at the following diagram of a eukaryotic gene Polyadenylation anal region (100bpl ADNA 11,000 pl (1000bp) Con 1450b) chel 1750 a) At which section would transcription initiation occur? List the letter of the section. (0.5pts) b) Identify all sections that would be present in the pre-mRNA transcribed from this gene. List the letter of these sections. (0.5pts) c) Name the three processes that must occur to create a mature processed mRNA in...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
MUN for the rapid SA can be enormously benehciarlo NS FOR FURTHER REVIEW be found in...
MUN for the rapid SA can be enormously benehciarlo NS FOR FURTHER REVIEW be found in the answer section at the back wers only after you have attempted to solve th at the back of this d to solve the ques- Answers to these questions can be found in the study guide. Refer to the answers only after you tions ON JONr Own. Multiple Choice 1. DNA genomes are found in: a. All organisms and all viruses b. All organisms,...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
Please read the article bellow and discuss the shift in the company's approach to genetic analysis....
Please read the article bellow and discuss the shift in the
company's approach to genetic analysis. Please also discuss what
you think about personal genomic companies' approaches to research.
Feel free to compare 23andMe's polices on research with another
company's. Did you think the FDA was right in prohibiting 23andMe
from providing health information?
These are some sample talking points to get you thinking about
the ethics of genetic research in the context of Big Data. You
don't have to...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
answer parts e, f, and g
4. Look at the following diagram of a eukaryotic gene Polyadenylation anal region (100bpl ADNA 11,000 pl (1000bp) Con 1450b) chel 1750 a) At which section would transcription initiation occur? List the letter of the section. (0.5pts) b) Identify all sections that would be present in the pre-mRNA transcribed from this gene. List the letter of these sections. (0.5pts) c) Name the three processes that must occur to create a mature processed mRNA in...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
MUN for the rapid SA can be enormously benehciarlo NS FOR FURTHER REVIEW be found in the answer section at the back wers only after you have attempted to solve th at the back of this d to solve the ques- Answers to these questions can be found in the study guide. Refer to the answers only after you tions ON JONr Own. Multiple Choice 1. DNA genomes are found in: a. All organisms and all viruses b. All organisms,...
Please read the article bellow and discuss the shift in the
company's approach to genetic analysis. Please also discuss what
you think about personal genomic companies' approaches to research.
Feel free to compare 23andMe's polices on research with another
company's. Did you think the FDA was right in prohibiting 23andMe
from providing health information?
These are some sample talking points to get you thinking about
the ethics of genetic research in the context of Big Data. You
don't have to...
Most questions answered within 3 hours.
-
Calculate the number density of argon gas at a temperature of
24C and a pressure of...
asked 41 minutes ago -
Alternative
Classification
How to Estimate
Probabilities from Data? ( For continuous Attributes)
And How to generate...
asked 43 minutes ago -
An explosion breaks a 20.0-kg object into three parts. The
object is initially moving at a...
asked 1 hour ago -
Calculate the approximate number of residues of Rubisco, which
is involved in carbon fixation in plants,...
asked 2 hours ago -
Other decisions about scientific claims can have a much broader
impact.ENERGYarrow-10x10.png, environment, health, security - all...
asked 3 hours ago -
I need to write a research paper and work cited about this
topic: The United States...
asked 3 hours ago -
Hello! I was wondering if I could have some help?
If the vapor pressure of carvone...
asked 4 hours ago -
An economist wants to estimate the mean per capita income (in
thousands of dollars) for a...
asked 4 hours ago -
What would be the input/output characteristic of a circuit
obtained by putting two of your 2's-complementers...
asked 4 hours ago -
In Drosophila, the transition from the syncytial blastoderm
stage to the cellular blastoderm stage is a...
asked 5 hours ago -
Project management question:
Name 3 different types of resources (hint: humans are one
type)
asked 5 hours ago -
Consider the following reaction: C 2H 2( g) + 2H 2( g) C 2H 6(
g)...
asked 5 hours ago