Here is the solution to the above question. The explanation is done in the code itself in the form of comments (see image) for better line by line explanation and better understanding.
Code:
import java.io.*;
public class as15{
// main class
private static int dna_to_rna(char[] dna)
{ // function to change DNA into
RNA
int k=dna.length;
// geting
the lendth of pass paramater dna
char[] rna=new char[k];
// creating a new array of char type of length
same as dna
for (int i = 0; i < dna.length; i++) {
// loop to copy dna into rna
and change T to U .
if(dna[i]=='T')
rna[i]='U';
else
rna[i]=dna[i];
}
for (int i = 0; i < rna.length; i++) {
// loop to print the
rna
System.out.print(rna[i]);
}
return 0;
}
public static void main(String args[])
// main
function
{
// string having DNA sequence
String s =
"AGTGAGATTCTGCGACTATGTTAACAGGTTGCATCCTGGCGAGTGGGAGGTCAATGTTGTTAGACTGATATGTCTTTATCTTGAGGCCCGGTGCACGGTCGTTGTGTACAATTCAATCTAGGGTCGGACAGCATTCTCGGGTGTCGCGCCTCCTTTACCACGCGACGCCGTACATGTGAGTGCGAGGGTTCAGAGAGTGCCAAGTATTGGCTTTCCCACTAACGATTTCGGATCTCAAGGCTGCCTTCAGACGGG";
char[] dna =
s.toCharArray();
// converting and storing strind into char
array
for (int i = 0; i < dna.length;
i++) { // printing the dna char
array
System.out.print(dna[i]);
}
System.out.println("\n");
// printing new line
dna_to_rna(dna);
// calling
the function dna_to_rnam to chang and print the rna.
}
}
Output:
Note: If you are still unable to understand, then comment with it and I will be happy to help.
Java source code ? Arrays Program 0 (Warm-up. 40 pts): Deoxyribonucleic acid, or DNA, is comprised...
***** PSEUDOCODE PLEASE****** ***** PSUDOCODE PLEASE****** Program 0 (Warm-up): Deoxyribonucleic acid, or DNA, is comprised of four bases: (G)uanine, (C)ytosine, (A)denine and (T)hymine. Ribonucleic acid, or RNA, is different than DNA in that it contains no Thymine; thymine is replaced with something called (U)racil. For this assignment, you will create an array of 255 characters. You must start by filling the array with random characters of G, C, A and T. You must then print out the array. Next, replace all the instances of Thymine...
The deoxyribonucleic acid (DNA) is a molecule that contains the genetic instructions required for the development and functioning of all known living organisms. The basic double-helix structure of the DNA was co-discovered by Prof. Francis Crick, a long-time faculty member at UCSD 0 The DNA molecule consists of a long sequence of four nucleotide bases: adenine (A), cytosine (C), gua- nine (G) and thymine (T). Since this molecule contains all the genetic information of a living organism, geneticists are interested...
Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...