Question

The deoxyribonucleic acid (DNA) is a molecule that contains the genetic instructions required for the development and functioning of all known living organisms. The basic double-helix structure of the DNA was co-discovered by Prof. Francis Crick, a long-time faculty member at UCSD 0 The DNA molecule consists of a long sequence of four nucleotide bases: adenine (A), cytosine (C), gua- nine (G) and thymine (T). Since this molecule contains all the genetic information of a living organism, geneticists are interested in understanding the roles of the variuos DNA sequence patterns that are con- tinuously being discovered worldwide. One of the most common methods to identify the role of a DNA sequence is to compare it with other DNA sequences, whose functionality is already known. The more similar such DNA sequences are, the more likely it is that they will function similarly Your task is to write a C program, called dna.c, that reads three DNA sequences from a file called dna input.dat and prints the results of a comparison between each pair of sequences to the file dna output.dat. The input file dna.input.dat consists of three lines. Each line is a single se- quence of characters from the set fa, c, G, T), that appear without spaces in some order, terminated by the end of line character n. You can assume that the three lines contain the same number of characters, and that this number is at most 241 (including the character \n). Here is a sample input file ACGTTTTAAGGGCTGAGCTAGTCAGTTCATCGCGCGCGTATATCCTCGATCGATCATTCT CTCTAGACGTTTT AGTCAGTTC ACGTTTTAAGGGCTTAGAGCTTATGCTAATCGCGCGCGTATATCCTCGATCGATCATTCT AGTTAGTTAGTTCATCGGCGGCGTATATCCTCGATCGATCATTCT CTCTAGACGTTTTAAGGGCTGAGCCGGTCAGTTA Each of the three lines (shown with wrap-around above) consists of 95 characters: the 94 letters from (A, C, G, T) and the character In (not shown). The output file dna.output.dat must be structured as follows. For each pair of sequences #1 and #j, with i,je {1,2,3) and i > j, you should print ·A single line, saying "Comparison between sequence #i and sequence ·The entire sequence #1 in the first row, and the entire sequence #1 in the third row. :" e The comparison between the two sequences in the second (middle) row. This should be printed as follows. For each position, if the two bases are the same in both sequences then the corresponding base letter (one of A, C, G, T) should be printed; otherwise a blank" "should be printed. . A single line, saying "The overlap percentage is x"where x is a floating-point num- ber which measures the pencentage of letters that match in the two sequences. This number should be printed with a single digit of precision after the decimal point. Each line in the output file dna output.dat should contain at most 61 characters, including the end of line character \n. If the DNA sequences are longer than that, then each of the three rows mentioned