ASSIGNMENT
DNA 3’—A T T G C T T A C T T G C A T -- 5’
DNA 5’--
To make the amino acid, read triplets from Left to Right.
DNA 3’- T A C C T A C T T T G C C C G A T C C A T– 5’
mRNA 5’---
amino acid
b. Read letter by letter from RIGHT TO LEFT ←←
To make the amino acid, read triplets from Left to Right
DNA 5’- T A C C T A C T T T G C C C G A T C C A T– 3’
mRNA 5’---
amino acid
RNA 5’— A U G—3’
DNA 3’--________--5’
How many potentialstart codons did you find?_______________
Line |
YOUR DNA SEQUENCE (read from left to right) |
1 |
1) 3’- T T C C G T A A C T T C G G C G C A T C T A G C T T G A G C T C C A A T C A G G |
2 |
2) A C T A C T T A T A A A A A T C T T C T C G A G A G A G C T T T A C T C C T A C T C |
3 |
3) T C T T A G T C G A T T C C A T C G G A C C T A C G A T T G A C A A G C G C G G T C |
4 |
4) T A C T A T C T A C T T A T T T A T T T A C G A G C G T T G A T T C T A C C T A C T G |
5 |
5) A C G A C T A G G G C A T T C T A T A G G A T T A A C T C C T T A T T T T A A C T A |
6 |
6) A C T T C C T G G G A A G G C G C C T T T A T C T G A T C C G T A A T C C G T C C G |
7 |
7) A A G G C T C T G A T C G G A T T A C T G G G T C A C T G G A A A G T G A C C G C T |
8 |
8) G T C T A T T A C T G T A T T T C A T C T G A T T G A C T A T T T T A T A G T C G -5’ |
DNA: 3’ –
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ -5’
mRNA: 5’-
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ - 3’
Amino acid sequence:______-______-_______-_______-______-_____-______-______-______-______-______-______-______-______-______-______-______-______
Template strand 3’- A T T G C T T A C T T G C A T - 5’
Coding strand 5’- T A A C G A A T G A A C G T A -3’
a.
Template strand: 3’- T A C C T A C T T T G C C C G A T C C A T-5’
Coding strand : 5’- A T G G A T G A A A CG G G C T A G G T A-3’
mRNA: 5’- AUG GAU GAA ACG GGC UAG G U A-3’
Amino acid: Met-Asp-Glu- Thr-Ala
b.
Coding DNA strand: 5’- T A C C T A C T T T G C C C G A T C C A T– 3’
mRNA: 5’- UAC CUA CUU UGC CCG AUC CAU– 3’
Amino acid: Tyr-Leu- Leu- Cys-Pro-Pro-Ile-Leu
No. Amino acid sequences from a and b are not same.
RNA 5’- A U G -3’
DNA 3’- T A C -5’
ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3P-A TIGOTTACTTGCA T-5° DNA 5'- 2) Does it matter which strand is the 'code strand"? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Read the DNAsequence given below in the 3’ to 5’ direction and circle all of thepotentialstart codons (i.e. every time you see the DNA version of a start codon- as in answer to question 3). How many potentialstart codons did you find?_______________ Line YOUR DNA SEQUENCE (read from left to right) 1 3’- T T C C G T A A C T T C G G C G C A T C T A G C T T G...