Question

INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Su
3) What 3 to 5 DNA sequence would correspond to a s AUG.3-start codon? U 6–3 RNA 5-A DNA 3- 4) Read the DNA sequence given
6) Identify the start codon that is immediately downstream (towards the 5 end, after the promoter) of the promoter. Indicate
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1) complementary dna strand:

1) DNA (Complementary strand is) 3-ATTGCYTACTTGCAT-5. 5. TAAC, AAT, AA (GTA - 3 2)DNA al 3-TACCTACTIT GCC CGATCCAT-S mRNAS

3)the DNA sequence that is corrosponding to AUG start codon is:

3 corresponds to The DNA sequence that AUG start codon is a RNA 5-AUG- 3 DNA 3 TAC

Add a comment
Know the answer?
Add Answer to:
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

    INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3P-A TIGOTTACTTGCA T-5° DNA 5'- 2) Does it matter which strand is the 'code strand"? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For...

  • ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the...

    ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand.   DNA    3’—A   T   T  G   C   T   T   A  C   T   T  G   C   A   T -- 5’ DNA    5’-- Does it matter which strand is the ‘code strand’? The following two sequences look identical, except one runs 3’-5’ and the other 5’-3’. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3’ and 5’ ends).  Use the Universal triplet code to...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • I have my own answers, i just want to check my work, thanks! Given the DNA...

    I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...

  • Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of...

    Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...

  • 1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or...

    1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or B) serves as the TEMPLATE strand for the transcription of a mRNA that contains both a start and a stop codon?    3.) Which number (1, 2, 3, 4, or 5) best approximates the location of the -10 consensus sequence?    4.) How many amino acids long is the protein encoded by the mRNA from this DNA sequence?    5.) What is the second...

  • 1. Label the template and coding strand. Label upstream and downstream ends.

    1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • Break the following DNA sequence into triplets. (Draw a line to separate triplets) CCG|ATA|CGC|GGT|ATC|CCA|GGG|CTA|ATT|CAA If the...

    Break the following DNA sequence into triplets. (Draw a line to separate triplets) CCG|ATA|CGC|GGT|ATC|CCA|GGG|CTA|ATT|CAA If the above code showed the bases on one strand of DNA, what would the complementary strand read? What would the code in problem #2 be transcribed into (What would the mRNA sequence be?) How many codons are there in the above problem? What is the three-letter sequence on a tRNA molecule called? How many different amino acids are there that make up all of the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT