Question

1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no introns in the coding sequence. Based on what you know about transcription, translation, and cellular trafficking, where would you expect the protein encoded by this gene to localize? Explain your reasoning.

ATGATGTCATTCGTATCCCTGCTACTAGTGGGCATTCTGTTCTGGGCGACCGAGGCGGAA CAGCTGACCAAATGCGAAGTGTTTCAGATGGTCTCAAAGGGTGAAGAAGCTGAAGGGCGG CACTCGACAGGTGGCATGGATGAATTGTATAAGAAGGACGAGCTCTAA

2. If you were to mutate the abovementioned gene to disrupt localization of the encoded protein, what mutation(s) would you introduce? Where would you expect the protein to now localize?

Answer 1

DNA Sequence:

AUGAUGUCAUUCGUAUCCCUGCUACUAGUGGGCAUUCUGUUCUGGGCGACCGAGGCGGAA CAGCUGACCAAAUGCGAAGUGUUUCAGAUGGUCUCAAAGGGUGAAGAAGCUGAAGGGCGG CACUCGACAGGUGGCAUGGAUGAAUUGUAUAAGAAGGACGAGCUCUAA

mRNA Sequence:

AUGAUGUCAUUCGUAUCCCUGCUACUAGUGGGCAUUCUGUUCUGGGCGACCGAGGCGGAA CAGCUGACCAAAUGCGAAGUGUUUCAGAUGGUCUCAAAGGGUGAAGAAGCUGAAGGGCGG CACUCGACAGGUGGCAUGGAUGAAUUGUAUAAGAAGGACGAGCUCUAA

Protein Sequence:

M M S F V S L L L V G I L F W A T E A E Q L T K C E V F Q M V S K G E E A E G R H S T G G M D E L Y K K D E L Stop

It is targeted to Endoplasmic reticulum (ER) lumen as it has the L L L V G I L F W A sequence which is required for import into the ER and the KDEL sequence at the C terminus, which is required for retention into ER lumen.

2. If the KDEL amino acids are mutated, the protein will be pass through the ER but is not retained. It will now be secreted. Mutations can be induced which replaces any of the KDEL amino acids with unrelated amino acid. However, no stop codon should be created prematurely.