Question

In 1994, Congress passed the DNA Identification Act which authorized the FBI to do 2 things: (1) create and maintain a national DNA database, and (2) establish standards for forensic DNA testing. Because the human genome is full of DNA tandem repeats and because they vary in the number of contiguous repeat units, it was decided to use tandem repeats to build the DNA database. In 1996, 13 loci were chosen to be the core short tandem repeats (STR) for CODIS. Combined DNA Index System. Al 13 loci consist of various tetramers, 4-base sequences, which have low mutation rates and follow the laws of probability (the number of times the tetramer repeats is completely random). The power of STR analysis comes from looking at multiple STR loci simultaneously. The more STR regions that are tested, the more discriminating the test becomes. The number of times a tetramer repeats affects the length of the STR. Eoch length is a different "alle". Because different numbers of repeats results in different STR lengths. gol electrophoresis can be used for analysis. Consider the STR on chromosome 7. Its tetramer is "gata" and if repeats anywhere from 5 to 16 times. How many different alleles does it have? The following is a 334-base sequence from chromosome 7 with the STR highlighted. Circle each tetramer. How many repeats are present? What is the probability that a person would inherit this allele? - Is any more or less likely to occur than the others? 1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggetg actatggagt 61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa 121 ctaacgatag atagatagat agatagatag atagatagat aga tagatag ataga tagat 181 agatagtttttttttatctc actaaatagt ctatagtaaa catttaatta ccaatattto 241 gtgcaattet gtcaatgagg ataaatgtgg aategttata attcttaaga atatatatte 301 cctctgagtttttgatacct cagattttaa ggcc How many copies of this "gata" locus does each human have? (Hint: How many copies of chromosome 7 does a person have?) – __ If this person's other chromosome has 8 repeats, how many bands would be visible after electrophoresis Which fragment length (allele) would end up closest to the well where the DNA was loaded? What is the probability that a person would inherit the second allele? What is the probability that a person would end up with this DNA fingerprint Show your calculation (Hint: Use the rule of multiplication.) Al 13 core STR loci used by the FBI are polymorphic Imaniy allelesl. In fact, each has more than 10 alles. In order to simplify the following calculations, assume that each of the STR loc has exactly 10 alleles. What would be the probability that a person's DNA would match the crime scene evidence for just one STR locus Show your calculation What would be the probability of a suspect's DNA matching all 13 loci? Would you convict him or her of the crime? Explain. 180 Pelab 19: DNA Fingerprinting

Answer 1

- How many different alleles does it have?

It can repeat anywhere from 5 to 16, that means it has 12 alleles which are the following: 5 repeats, 6 repeats, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 repeats.

- Circle each tetramer.

1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggetg actatggagt 61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa 121 ctaadgatal ata atalgat algatagatag atapata at watapatay ate atatat 181 lata tttttttttatetc actaaatagt ctatagtaaa catttaatta ccaatatata 241 gtgcaattet gtcaatgagg ataaatgtgg aategttata attettaaga atatatatte 301 cctctgagtt tttgatacct cagattttaa ggcc

- How many repeats are present?

15

- What is the probability that a person would inherit this allele?

This cannot be known. I think your teacher amde a mistake thinking that we could suppose all the alleles have the same probabilities of occurring, but that is wrong, different alleles may have different alleles frequencies, and we cannot know that if we are not given with either genotype frequencies or directly allele frequencies.

But if your teacher is assuming all the alleles have the same frequencies, then this allele occurrance probability is 1/12 = 0.083, or 8.3%

- Is any more or less likely to occur than the others?

Following the same logic from the previous question's discussion, the answer would be: it has the same probability of occurring.

- How many copies of gata locus does each human have?

Each human has 2 copies, because we are diploid organisms.

- How many bands would be visible after electrophoresis?

Two bands, one that runned further in the gel for the 8 gata repeats, and another that runned slower for the 15 repeats.

- Which fragment length would end up closest to the well where the DNA was loaded?

The fragment of 15 repeats in length. That is because electroforesis works by providing a molecular net that will get more easily stuck the larger molecules, while the smaller molecules will pass easier through it reaching larger distances. The 15 repeats allele is bigger, so it will not be able to travel as far as the 8 repeats.

- What is the probability that a person would inherit the second allele?

Okay, again we have a problem here, because we have to assume wrong things about allele frequencies in the populations, but let's keep going with our assumption about equal allelic frequencies.

The probability of inheriting this allele is again 1/12 = 0.083

- What is the probability that a person would end up with this DNA fingerprint?

The probability of 2 events ocurring is the product of multiplying both independent probabilities:

(0.083)(0.083) = 0.006889

- What would be the probability that a person's DNA would match the crime scene evidence for just one STR locus?

Okay, now the probability for each allele would be 1/10 = 0.1, and the fingerprint (both allele copies) would be (0.1)(0.1) = 0.01

- What would be the probability of a suspect's DNA matching all 13 loci?

Now we have to multiply the 13 probabilities of 0.01, that's to say, elevate 0.01 to the 13th potency:

0.0113 = 1x10-24, that is a very low probability

- Would you convict him or her for the crime?

Yes, because that number means only 1 person out of 1,000,000,000,000,000,000,000,000 (24 zeros) has such fingerprint, the probability of conviting an inocent is very very low