We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
What one of the followings will finish DNA synthesis to make complete double stranded DNA if...
3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication....
1. If DNA polymerase III was going to attach a new nucleotide onto the DNA molecule shown to the right, where would it attach it? 2. Why are the ends labeled A and C different? a. The diagram is drawn incorrectly, they should be the same One is o pure onsa pyrimidine. c. One is a purine, one is a pyrimidine d. Double-stranded DNA is antiparallel. e. This is after DNA replication -before DNA replication, they look the same. 3....
Draw a figure of one double stranded DNA molecule that has initiated replication and produced two okazaki fragment in each lagging strand. The figure must include both template strands, all newly synthesized DNA molecules on both leading and lagging strands, all RNA primers, direction of chain growth for each fragment/strand indicated with arrowheads, direction of replication forks. Each molecule must be labeled with the origin of replication on both strands, leading and lagging strands labeled, template or newly synthesized, DNA...
Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...
Formation of a replication fork results in: A. continuous synthesis of DNA on the lagging strand. B. supercoiling in the parental DNA ahead of the fork. C. of new 3' -OH regions on the template DNA. D. binding of SSB protein on the double-stranded parental DNA. E. All of the above occur when the replication fork is formed.
are these correct? I also need help with the blanks - MATCHING (In each blank place the letter of the term in the blank next to appropriate phrase. Use letters only once you might not need all letters) repeats M. Replication - MATCHING (In each blank, the most appropria RNA polymerasel DNA polymerase RNA polymerase Il S→ 3' delta/epsilon RNA polymerase 111 3-5 exonuclease DNA polymerasel semiconservative activity DNA polymerase II short tandem DNA 5'3'exonuclease DNA polymerase III activity DNA...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...
1)Repairing damaged DNA is essential to maintaining the integrity of the genome. One type of repair is known as nucleotide excision repair. In this system, which order do the necessary enzymes act? A) exonuclease, DNA polymerase III, RNA primase B) helicase, DNA polymerase I, DNA ligase C) DNA ligase, nuclease, helicase D) DNA polymerase I, DNA polymerase III, DNA ligase E) endonuclease, DNA polymerase II, DNA ligase 2) What might be the result if all cells had functioning telomerase? A)...
44. During DNA replication, the double helix is unwound, creating two single strands. One of these is called the strand, on which the progress of DNA Polymerase III is – 45. The other strand is called the strand, on which the synthesis is 16. During DNA replication, synthesis of a new sequence on the Leading Strand is continuous. Why is synthesis on the Lagging Strand discontinuous? 47. Generation of Okazaki fragments proceeds in three steps. Indicate which of the following...
NA primase is TRUE? 27. Which ONE of the following statements about DNA primase is in polymerase cannot extend a new A) It is necessary for DNA synthesis because DNA polymerase canno strand in the 3 to 5' direction. B) It proofreads bases added by DNA polymerase. C) It is a type of RNA polymerase. D) It has terminal transferase activity. 28. How many of the following statements about PCNA are TRUE? • It encircles ssDNA. • It is an...