Question

genetic questions

25. Trinucleotide repeat regions in DNA sequences where the repeat region can hydrogen bond into a single-stranded stem-loop structure often lead to mutations. a. Frameshift b. Transition c. Transversion d. Base substitution 26. The following graph shows two very similar populations: population a and population b. Assuming all else is equal between these populations aside from what is in the graphs, which population's trait value (i.e., phenotype for a particular trait) would you expect to change over time more quickly due to directional selection? a. Population a b. Population b c. Neither will evolve. d. Both will evolve equally quickly e. It's unknown given this information. Midparent phenotypic value Midparent phenotypic value 27.Given the graph in the figure above, what do you expect to be the result of directional selection? a. They will both evolve to higher trait values. b. They will both evolve to lower trait values. c. Population a won't evolve and population b will evolve to higher trait values. d. Neither population will evolve. e. Unknown, we need to kn ow the direction of directional selection in order to decide. Offipring phenotypik value anRA3gd4ouayd Aaduo

Answer 1

Answer. (a) Frameshift

Stem loop structures are formed when the DNA sequence contains inverted repeats separated by a short sequence.

eg: AAAAAAAAGTACTTTTTTTT

T   A

G C

A =T

A =T

A =T

A =T

A =T

A =T

A =T

A= T

Presence of such stem loop structure leads to deletion of the intervenning sequence and thus leading to frameshift mutations.

At the time of DNA replication, the base sequence in the stem loop is not accessible to the DNA polymerase which then skips these bases, leading to their deletion.

Base substitution involve substitution of one base by another. Like an A being substituted by G.

These are called point mutations.

If because of a point mutation a purine is replaced by another purine or a pyrimidine is replaced by another pyrimidine, it is called transition.

eg: A is replaced by G or T is replaced by C.

If because of a point mutation a purine is replaced by a pyrimidine or a pyrimidine is replaced by a purine, it is called transversion.

eg: A is replaced by T or C is replaced by G.

As per HOMEWORKLIB RULES I can answer only 1 question. If you want answers to all the questions please send them separately.